... Заданный мне код фермента - EC 2.3.1.61. ... uniprot-AllText:EC*] [uniprot-AllText:2.3.1.61*]) | uniprot-AllText:EC 2.3.1.61*]) (([uniprot-ID:*_ECOLI*] | ... Length: 496 . Identity: 175/496 (35.3%) . Similarity: 250/496 (50.4%) . Gaps: 124/496 (25.0%) . Length: 486 . Identity: 188/486 (38.7%) . ... Length: 233 . Identity: 139/233 (59.7%) . Similarity: 178/233 (76.4%) . Gaps: 2/233 ( 0.9%) . ... Identity: 142/233 (60.9%) . Similarity: 177/233 (76.0%) . ...

Еще в разделе: (Показать все результаты (>2834) - kodomo.cmm.msu.ru/ )

• Task 7
• Классификация функций. Коды ферментов.
• Task 1 (UniProt)

Электронная библиотека Попечительского совета . ... Drensky V., Formanek E. - Polynomial Identity Rings . ... Название: Polynomial Identity Rings . Авторы: Drensky V., Formanek E. Аннотация: . ... Equivalent polynomial identities 8 . ... Formanek polynomial 148 154 160 174 . ... Homogeneous polynomial identity 10 . ... Multilinear polynomial identity 10 . ... Weak polynomial identity, essential weak identity 50 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>2544) - lib.mexmat.ru/ )

• Поиск книг, содержащих Функции выбора (проектирующие функции) (identity
• Поиск книг, содержащих Отображение тождественное (identity map(ping)) ::
• Поиск книг, содержащих Бьянки тождество (Bianchi identity) :: Электронная

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>10) - psyberlink.flogiston.ru/ )

... Главная -> Фильмы -> Identity . ... Фильмы . ... Identity . ... Однако вскоре ониљс ужасом обнаруживают, чтољэто место становится нељспасительным укрытием, аљсмертельной мышеловкой.Люди гибнут один заљдругим, аљубийца, скрывающийся среди них, по-прежнему нељвычислен. ... всю дорогу пока смотрела фильм выла просто в шоке от того, насколько это великолепно. ... Что касается общей идеи фильма - смотрите внимательно, и все прекрасно поймете. Такие фильмы надо смотреть ОЧЕНЬ внимательно. [ eredory ] . ...

Еще в разделе: (Показать все результаты (>45) - kinfo.ru/ )

• The Bourne Identity - Фильмы - Kinfo.ru
• The Bourne Identity Crisis - Фильмы - Kinfo.ru
• Identity Kills - Фильмы - Kinfo.ru

... Полная версия этой страницы: Инженер Identity Management. Студенческий форум Физфака МГУ > Общий > Работа . ewigen . ... В крупную Российскую IT компанию приглашаем инженеров по направлению . Identity Management. ... Опыт разработки web - приложений для java . Опыт работы в IT, как плюс . ... Знание систем Identity, как плюс. ... Соц. пакет согласно политике компании . Обучение внутри компании . ...

Еще в разделе: (Показать все результаты (>66) - wasp.phys.msu.ru/ )

• Инженер Identity Management. - Студенческий форум Физфака МГУ

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>187) - istina.msu.ru/ )

• Self and Identity - журнал | ИСТИНА - Интеллектуальная Система Тематического
• National Identities - журнал | ИСТИНА - Интеллектуальная Система Тематического

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . ChangeLog . 2016-Jan-25 18:42:16 . 2.4K . application/octet-stream . ChangeLog-2015 . 2015-Nov-09 07:11:44 . 1.2K . application/octet-stream . Manifest . 2016-Jan-25 18:42:16 . 2.6K . application/octet-stream . User-Identity-0.930.0-r1.ebuild . 2015-Aug-09 03:38:18 . 0.4K . text/plain . User-Identity-0.940.0.ebuild . 2015-Aug-09 03:38:18 . 0.4K . text/plain . metadata.xml . 2016-Jan-25 02:06:09 . 1.1K . text/xml . lighttpd/1.4.35

Еще в разделе: (Показать все результаты (>5220) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-python/service_identity/

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: [15] 9, my Matteo and identity business T . ... a href=http://discountisabel.webs.com/><b>isabel marant</b></a> Today, let`s see together how Victoria Beckham dress herself up.. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>667) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: identity continent. market

Program: matcher # Rundate: Tue Apr 04 2006 13:14:21 # Align_format: markx0 # Report_file: 1to3.matcher ######################################## #======================================= # # Aligned_sequences: 2 # 1: # 2: # Matrix: EBLOSUM62 # Gap_penalty: 14 # Extend_penalty: 4 # # Length: 16 # Identity: 13/16 (81.2%) # Similarity: 14/16 (87.5%) # Gaps: 0/16 ( 0.0%) # Score: 64 # # #======================================= 130 SYSFVAMAKACRSMLN .: ...

Еще в разделе: (Показать все результаты (>2822) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term4/Block1/protein.txt
• http://kodomo.fbb.msu.ru/~element/Term4/Block1/nucleot.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/1NZJ/downloads/aln.water

The Salzburg Seminar announces American Studies Center Session 27 entitled . RACE, ETHNICITY, RELIGION AND AMERICAN IDENTITY . ... Participants will be sociologists, journalists, and university teachers of American Studies, including historians and literary scholars, who are interested in the ethnic, racial and religious developments that have influenced contemporary American society. ... Also see the Salzburg Seminar website at http://www.salzburgseminar.org and click on American Studies Center. ...

Еще в разделе: (Показать все результаты (>31) - www.prof.msu.ru/ )

• PROGRAM INFO

... 1) to analyze comparatively the links between confessional peculiarities of Europe's religious traditions and crucial aspects of cultural/ethnic/national identities in those regions of Europe, where Catholicism, Orthodoxy, and Protestantism were dominating in Middle Ages and in the Early Modern Period; . ... research seminar at the Central European University (Budapest) "Confessional Traditions in Shaping Cultural Identities in Europe" . ... How they are related to religious/confessional traditions?...

Еще в разделе: (Показать все результаты (>61) - hist.msu.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... The live in the North is a waiting of a vacation and a New Year holiday.. ... Theoretical approach: vacation as a temporal geographic proximity Temporal proximity theory: A. Torre Base for temporal proximity as a solid base of interregional contacts: -The system of two (or more) dwelling (both in the North and the South ) - Social networks Institutional conditions of proximity usage: - A paid vacation trip for all having job in Russian Arctic -Readiness to use weak ...

Еще в разделе: (Показать все результаты (>29) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/cafedra/segzs/nauchd/pubs/Urban_identities_Tokyo_and_LA.doc

... 2015 . ... Ph.D., associate professor, Department of History of Russian State, School of Public Administration, Lomonosov Moscow State University. ... The paper analyses how the state power seeks to influence the historical identity of population and how the population adapts or rejects official ideology. ... No material published in this journal may be reproduced in print or in electronic form without a link to "E-journal. Public Administrarion". ... Copyright ї 2015 SPA MSU . ...

Еще в разделе: (Показать все результаты (>20) - ee-journal.spa.msu.ru/ )

Title Author Key words Theoretical Approaches to Identity in Contemporary Social Science Mamedov A.K., Yakushina O.I. identity, individual, society, identity construction, concepts of identity Identity and the factors influencing its construction in the contemporary society from the point of view of modern identity concepts are discussed. In contemporary society the definition and construction of the individual identity is one of the most important problems. ... Abstract ...

Еще в разделе: (Показать все результаты (>10) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/181.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/2/03.pdf
• Вестник МГУ

. Первая страница Назад Продолжить Последняя страница Обзор Графические объекты .

Еще в разделе: (Показать все результаты (>26) - uneex.lorien.cs.msu.su/ )

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... OpenID Identity . Type your OpenID identity you want to use. ... Site map . Site search . MSU website . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

18. Psychology in Russia: State of the Art, Vol. 3, 2010

19. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

20. Клуб выпускников МГУ: Конференция "Вакансии"