... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>257) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Video-based tracking | Graphics and Media Lab
• Grants and contracts | Graphics and Media Lab

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2058) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• Аннотация статьи о Vibrio fischeri
• Term3/Блок 2

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>83) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... 2015 Analysis of the complete genome sequences of new isolates of the genetically diverse Winona strain of Plum pox virus (PPV W) and the first definitive evidence of intra-strain recombination events . ... 2012 Occurence and genetic diversity of Winona-like Plum pox virus isolates in Russia . ...

Еще в разделе: (Показать все результаты (>2172) - istina.msu.ru/ )

• Phytopathology - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Beletskii A.B. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• SPE Drilling and Completion - журнал | ИСТИНА - Интеллектуальная Система

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>68) - brain.bio.msu.ru/ )

• Analysis of change-point synchronization in multi-channel EEG

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>960) - chem.msu.ru/ )

• Entrance Examinations - Preliminary Round

. [ Войти ] . Главная -> Фильмы -> Lego Star Wars: The Complete.. Пользователи . Демо . Деньги . Фильмы . Форум . Lego Star Wars: The Complete Saga . Великобритания 2007 . отметить . Комедия . Фантастика . Игра . Фэнтэзи . Боевик .

Еще в разделе: (Показать все результаты (>56) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Complete Guide to Guys - Фильмы - Kinfo.ru

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>1879) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/xfree86os2/ports/X333bonus/README
• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• Historical Notes

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>123) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>180) - hist.msu.ru/ )

... Navier-Stokes Based Models in Computational Aeroacoustics . ... The same high accuracy numerical scheme is proposed for the numerical implementation of all the models. It is illustrated that a good efficiency of predictions is provided not only by the scheme accuracy, but also by such computational properties as differential model accuracy and round off errors. The following particular aspects are discussed: the influence of nonlinear effects and the treatment of very small perturbations. ...

Еще в разделе: (Показать все результаты (>121) - acs366.phys.msu.su/ )

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>17) - angel.cs.msu.su/ )

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>104) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>19) - cdfe.sinp.msu.ru/ )

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>276) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>52) - dfgm.math.msu.su/ )

• Conference dedicated to the memory of Professor Yu. P. Solovjev
• 1st Announcement

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>33) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>201) - itpm.msu.su/ )

• Dialing out with chat
• A Gentle Introduction to Taylor UUCP
• Kernel Options in 1.0 and Higher

... Line: 82 to 82 . ... rcstext ::= admin {delta}* desc {deltatext}* admin ::= head {num}; { branch {num}; } access {id}*; symbols {sym : num}*; locks {id : num}*; {strict ;} { comment {string}; } { expand {string}; } { newphrase }* delta ::= num date num; author id; state {id}; branches {num}*; next {num}; { newphrase }* desc ::= desc string deltatext ::= num log string { newphrase }* text string num ::= {digit | ... 9 id ::= {num} idchar {idchar | num }* sym ::= {digit}* idchar {idchar | ... num | ...

Еще в разделе: (Показать все результаты (>32674) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (15 vs. 19) - TWiki
• %TOPICTITLE% (13 vs. 14) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>71) - chaos.phys.msu.ru/ )