... file . ... annotate . ... project.py: EXTREMELY ugly method to calculate the identity percentage of alignment columns for colouring has been added. ... BurkovBA@0 . ... 6 import sequence . ... 9 class Block ( object ): . ... 12 * self.project -- project object, which the block belongs to . ... 22 >>> block1 = block.Block(proj, proj.sequences, range(len(proj.alignment[proj.sequences[0]]))) . ... 26 def __init__ ( self , project , sequences , positions ): . ... 31 def to_fasta ( self , file ): . ...

Еще в разделе: (Показать все результаты (>112832) - kodomo.fbb.msu.ru/ )

• allpy: lib/project.py diff
• allpy: lib/project.py history
• allpy: 0905a39738f2

... annotate . ... 6 def __init__ ( self , position , velocity , lifetime , mutated ): . ... 23 def check_collision ( self , bacteria , delta , bact_r , delta_t ): . ... 34 def move ( self , bacteria , delta_t , radius , delta , bact_r ): . ... 40 def collision ( self , other , bacteria , delta_t , radius , delta , bact_r ): . ... 52 def asexual ( self , bacteria , delta_t , radius , delta , bact_r , full_lifetime ): . ... 67 def sexual ( self , other , bacteria , delta_t , radius , delta , bact_r , . ...

Еще в разделе: (Показать все результаты (>4305) - kodomo.cmm.msu.ru/ )

• petri_dish: scale.py annotate
• petri_dish: tk1.py annotate
• petri_dish: Petri.py annotate

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6980) - mouse.belozersky.msu.ru/ )

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>110) - www.genebee.msu.ru/ )

• Genebee Predicted Annotation
• Genebee Predicted Annotation - Advanced

. PHP Manual . Prev . Next . (PHP 4 ) pdf_add_bookmark -- Adds bookmark for current page . int pdf_add_bookmark ( int pdf object, string text [, int parent [, int open]]) . Add a nested bookmark under parent , or a new top-level bookmark if parent = 0. Returns a bookmark descriptor which may be used as parent for subsequent nested bookmarks. If open = 1, child bookmarks will be folded out, and invisible if open = 0. Prev . Home . Next . pdf_add_annotation . Up . pdf_add_launchlink

Еще в разделе: (Показать все результаты (>112) - oit.cmc.msu.ru/ )

• pdf_add_annotation
• pdf_add_launchlink
• cpdf_add_annotation

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... CommentPluginTemplate 4 - 2006-12-16 - Main.TWikiContributor . Line: 1 to 1 . ... Line: 261 to 261 . ... Talk using TOC adding on end - TWiki:Main/FranzJosefSilli . Create a list of annotated bookmarks - TWiki:Main/FranzJosefSilli . ... Revision 4 . ... Copyright by the contributing authors. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.CommentPluginTemplate . ...

Еще в разделе: (Показать все результаты (>27905) - dualopt1.cmm.msu.ru/ )

• VarTABLE - TWiki - TWiki - (printable)
• VarTABLE - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

This diagram shows how the 'vertical-align' properties on cells combine to determine the height of the row containing the cells. The diagram also illustrates the meaning of some values of 'vertical-align' that apply to table cells: baseline, top, bottom, and middle. The diagram shows a row of five (labeled) table cells of varying heights and alignments. ... The first cell is aligned with the row baseline and extends to just below the row top. ...

Еще в разделе: (Показать все результаты (>1329) - crydee.sai.msu.ru/ )

• E.V.Kononovich

... Applied Geochemistry , 1999, 14 (2): 95-107. Potential response of forest soils to sulphur deposition in the Norwegian-Russian border area in the surroundings of the Pechenganikel smelters, the major sulphur emitters in the northern Europe, has been assessed with the PROFILE model. The release rate of base cations due to weathering range from 0.05 to 0.28 kmolc/ha/yr in the 0 - 50 cm soil layer, thus demonstrating the high sensitivity of the coarse and thin podzols studied. ...

Еще в разделе: (Показать все результаты (>39) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".

... It is reasonable to expect a priori that the evolution of events is strongly time dependent, so the star formation history in a galaxy is another important parameter. Therefore, by calculating the evolution of events after a -function like star formation burst,   one gets a Green function for any arbitrary star formation history. ... The source evolution in a galaxy with given star formation rate is thus calculated as . ...

Еще в разделе: (Показать все результаты (>365) - xray.sai.msu.ru/ )

• Calculation of binary NS coalescence rates
• Shakura Nikolai Ivanovich
• Seminars

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes
• ConClus

Automatic identification of horizontal gene transfer events in bacterial genomes Manolov A.1, Kanygina A. 1 2 Research Institute of Physical and Chemical Medicine, Moscow Moscow Institute of Physics and Technology, Moscow 2 Horizontal gene transfer (HGT) is a major force of bacterial evolution. ... Some of them are based on the multiple alignment of genetic sequences, other perform the search for HGT de novo (having no reference sequence). ...

Еще в разделе: (Показать все результаты (>172) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/164.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Online . ... More than 40 000 students (graduate and postgraduate) and about 7 000 undergraduates study at the university, and over 5 000 specialists do the refresher course here. ... Moscow University campus is an extremely complex system, with its 1 000 000 m2 floor area in 1 000 buildings and structures, with its 8 dormitories housing over 12 000 students and 300 km of utility lines. ...

Еще в разделе: (Показать все результаты (>19) - www.msu.ru/ )

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>5603) - monkey.belozersky.msu.ru/ )

• About this project
• About authors ot this complex
• SDP home page

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>16) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• Algorithm

... 2010 November 9 . NGC 4452: An Extremely Thin Galaxy . ... NGC 4452, a galaxy in the nearby Virgo Cluster of Galaxies , is so thin that it is actually difficult to determine what type of disk galaxy it is. ... Near NGC 4452 's center is a slight bulge of stars, while hundreds of background galaxies are visible far in the distance. ... Galaxies that actually are this thin are relatively common -- for example our own Milky Way Galaxy is thought to be about this thin . ... About APOD | ...

Еще в разделе: (Показать все результаты (>1084) - www.sai.msu.su/ )

• Oleg Bartunov's Home Page
• About APOD
• Jenam 2000

... NGC 4452: An Extremely Thin Galaxy . ... In one of the more precise alignments known in the universe, what is pictured above is actually a disk galaxy being seen almost perfectly edge on. The image from the Hubble Space Telescope is a spectacular visual reminder of just how thin disk galaxies can be. NGC 4452, a galaxy in the nearby Virgo Cluster of Galaxies , is so thin that it is actually difficult to determine what type of disk galaxy it is. ... NGC 4565: Galaxy on Edge . ...

Еще в разделе: (Показать все результаты (>5383) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• A 212 Hour Exposure of Orion
• The Annotated Galactic Center

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>48) - scon155.phys.msu.su/ )

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>10) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

CompHEP was created as a program for calculation in an interactive mode. ... During the work with the n_comphep_f(c) program in the interactive mode you have a possibility to store all current settings and task parameters in the f(c)_batch.dat file. The function Batch of the main menu is used to define such a task and save it in a file. ... Its first function appends parameters of the current session to the f(c)_batch.dat file. ... The batch calculation in the case of n_comphep_c is started by . ...

Еще в разделе: (Показать все результаты (>548) - theory.sinp.msu.ru/ )

• Contents
• Numerical calculation by CompHEP
• Menu system for symbolic calculation

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI= 5 LANGS = de pl ru uk inherit cmake-utils git-r3 DESCRIPTION= Qt4 Crossplatform Jabber client HOMEPAGE= http: ... annotations autostatus avatars birthdayreminder bitsofbinary bookmarks captchaforms chatstates clientinfo commands compress console dataforms ...

Еще в разделе: (Показать все результаты (>7009) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/eclass/mozconfig-3.eclass
• Index of /pub/gentoo-portage/dev-java/jackson-module-jaxb-annotations/
• Index of /pub/gentoo-portage/dev-java/jackson-annotations/