Электронная библиотека Попечительского совета . ... Hu S.T. - Introduction to general topology . ... Название: Introduction to general topology . Автор: Hu S.T. Язык: . ... Basis, of a topology 17 . ... Coarser topology 17 . ... Discrete topology 16 . ... Finer topology 17 . ... Half-open interval topology 20 93 . ... Identification topology 43 . ... Indiscrete topology 17 . Induced topology 29 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12015) - lib.mexmat.ru/ )

• Tourlakis G.J. - Lectures in Logic and Set Theory: Mathematical Logic ::
• Hu S.-T. - Elements of real analysis :: Электронная библиотека попечительского
• Hinman P.G. - Fundamentals of Mathematical Logic :: Электронная библиотека

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>106) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>343) - chem.msu.ru/ )

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>103) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. April 2, 1997 . A Complete Aurora . ... U. Iowa ), Polar , VIS , NASA . Explanation : Aurora frequently make complete rings around a pole of the Earth. ... A complete aurora l oval is normally hard to photograph because part of it usually occurs over a brightly sunlit portion of the Earth. ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>1928) - www.sai.msu.su/ )

• APOD: 2007 December 3 - A Complete Solar Cycle from SOHO
• FTS Complete Tutorial
• SAL- Numerical Analysis - Optimization - NP-Completeness

... A Complete Solar Cycle from SOHO . ... 3.12.2007 . ... Credit: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... Solar minimums occurred in 1996 and 2007, while the last solar maximum occurred in 2001 Pictured above is a SOHO image of the Sun in extreme ultraviolet light for each year of the last solar cycle , with images picked to illustrate the relative activity of the Sun. ... Publications with keywords: solar cycle - solar maximum - SOHO ...

Еще в разделе: (Показать все результаты (>5453) - www.astronet.ru/ )

• A Complete Aurora
• Астронет > A Complete Solar Cycle from SOHO
• Астронет > A Complete Aurora

. [ Войти ] . Главная -> Фильмы -> Lego Star Wars: The Complete.. Пользователи . Демо . Деньги . Фильмы . Форум . Lego Star Wars: The Complete Saga . Великобритания 2007 . отметить . Комедия . Фантастика . Игра . Фэнтэзи . Боевик .

Еще в разделе: (Показать все результаты (>90) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Complete Guide to Guys - Фильмы - Kinfo.ru

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>1692) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt

A stream of data provided to a QNPInstance by the browser. This class is part of the Qt NSPlugin Extension. ... QNPStream ?()? . const?char*? url ?()?const . ... bool? seekable ?()?const . bool? okay ?()?const . ... void? requestRead ?(?int?offset, uint?length?)? . ... QNPStream ?(?QNPInstance?*, const?char?*, _NPStream?*, bool?)? . ... Creates a stream. ... Returns TRUE if the stream has received all the data from the source. ... Returns the QNPInstance for which this stream was created. ...

Еще в разделе: (Показать все результаты (>596) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QFileInfo member list
• Qt Toolkit - QNPStream member list
• Qt Toolkit - application/application.cpp example file

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>117) - www.mce.biophys.msu.ru/ )

. PHP Manual . Prev . Next . (PHP 4 >= 4.0.0) readline_completion_function -- Registers a completion function . bool readline_completion_function ( string line) . This function registers a completion function. You must supply the name of an existing function which accepts a partial command line and returns an array of possible matches. This is the same kind of functionality you'd get if you hit your tab key while using Bash. Prev . Home . Next . readline_clear_history . Up . readline_info

Еще в разделе: (Показать все результаты (>369) - oit.cmc.msu.ru/ )

• Parser behavior
• Missing functions
• Creating Extensions

... 2016-Apr-09 18:10:24 . ... application/octet-stream . ... 3.0K . text/plain . ... text/xml . ...

Еще в разделе: (Показать все результаты (>17412) - mirror.msu.net/ )

• Index of /pub/slackware-current/extra/source/bash-completion/
• Index of /pub/gentoo-portage/app-emacs/scheme-complete/
• Index of /pub/gentoo-portage/app-shells/zsh-completions/

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>113) - www.psy.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>877) - istina.msu.ru/ )

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>150) - num-meth.srcc.msu.ru/ )

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>33) - angel.cs.msu.su/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>1155) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>3021) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Over virtually the complete
• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Laboratories: Laboratory for Ecology of Arid Territories: Publications

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>9678) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: log

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>4) - bioinf.fbb.msu.ru/ )