Электронная библиотека Попечительского совета . ... Kim K. - Electronic and Algorithmic Trading Technology: The Complete Guide . ... Название: Electronic and Algorithmic Trading Technology: The Complete Guide . ... Advance Praise for Electronic and Algorithmic Trading Technology "Kendall Kim's Electronic and Algorithmic Trading Technologyis well written, thoroughly researched, and logically organized. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>113531) - lib.mexmat.ru/ )

• Farr J.M. - Top 100 Computer and Technical Careers: Your Complete Guidebook to
• Ahson S.A. (ed.), Ilyas M. (ed.) - WiMAX: Technologies, Performance Analysis,
• Youssef H.A., El-Hofy H. - Machining Technology: Machine Tools and Operations

... Grants and contracts . ... Graphics Media lab is a leader in international cooperation among laboratories of Department of computational mathematics and cybernetics, Lomonosov Moscow State University. ... Grant RFBR 14-01-00849 "People detection, tracking and annotation in video streams". ... Contract ?Advanced video processing for various video applications?, ... Contract ?Energy efficient video transmission over wireless channel and advanced video processing for various video applications?, ...

Еще в разделе: (Показать все результаты (>272) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

NCR WorldMark 5250 Server TM Large-Scale MPP Teradata @ctive WarehouseTM The WorldMark 5250 and Teradata offer a completely integrated active warehousing solution with optimized system performance. ... Backed by award winning professional services, support and the strength of NCR's demonstrated data warehousing expertise, the WorldMark 5250 system offers the solid foundation you need to protect your data and your investment, securing the growth needed for leadership in today's business environments. ...

Еще в разделе: (Показать все результаты (>673) - www.parallel.ru/ )

• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по
• Return status | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Semantics of Nonblocking Communications | PARALLEL.RU -

NP-Completeness . Software with efficient algorithm designing for hard computational problems. It includes a new NP-complete problem named SAT01, which is suitable for reduction to it and for solving algorithms development. ... Home Site: . ... None . ... User Comments: . ... SAL Home | Numerical Analysis | Optimization . Comments? SAL@KachinaTech.COM . Copyright 1995-2001 by Herng-Jeng Jou . Copyright 1997-2001 by Kachina Technologies, Inc. ...

Еще в разделе: (Показать все результаты (>5347) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Misc - LInteger
• SAL- Programming - Languages Compilers - GNAT
• SAL- Numerical Analysis - Misc - ATLAS

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>164) - www.prof.msu.ru/ )

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• MSU's HPC HISTORY | Moscow University Supercomputing Center
• MSU SUPERCOMPUTERS: "LOMONOSOV" | Moscow University Supercomputing Center
• HOPSA - the joint RF/EU project: HOlistic Performance System Analysis | Moscow

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>89) - www.kosmofizika.ru/ )

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>6) - vserv.sinp.msu.ru/ )

... Другие названия журнала: MOLECULAR CRYSTALS AND LIQUID CRYSTALS SCIENCE AND TECHNOLOGY SECTION C - MOLECULAR MATERIALS . ... Sergeev B.M. , Sergeev G.B. , Kasaikin V.A. , Litmanovich E.A. , Prusov A.N. в журнале MOLECULAR CRYSTALS AND LIQUID CRYSTALS SCIENCE AND TECHNOLOGY SECTION C-MOLECULAR MATERIALS , том 356, с. 121-129 . ... Kashkarov P.K. , Zheltikov A.M. в журнале MOLECULAR CRYSTALS AND LIQUID CRYSTALS SCIENCE AND TECHNOLOGY SECTION C-MOLECULAR MATERIALS , том 23, ? ...

Еще в разделе: (Показать все результаты (>4530) - istina.msu.ru/ )

• Infrared Physics and Technology - журнал | ИСТИНА - Интеллектуальная Система
• Technology Analysis and Strategic Management - журнал | ИСТИНА -
• IEEE Photonics Technology Letters - журнал | ИСТИНА - Интеллектуальная Система

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>78) - engineering.phys.msu.ru/ )

• Parallel Programming
• Circuit Diagnostics

... Computer systems in science and education . ... Analysis of Complex Biological Systems: Models and Experiment . ... Analysis of Complex Biological Systems: Molecular Biophyics . Analysis of Complex Biological Systems: Medical Topics . ... Analysis of Complex Biological Systems: General Biology and Ecology . Analysis of Complex Biological Systems: Models of Subcellular Systems . Analysis of Complex Biological Systems: Physiology and Biomedicine . ... Analysis of Complex Biological Systems. ...

Еще в разделе: (Показать все результаты (>13946) - www.mce.biophys.msu.ru/ )

• Conference publications
• Books : Физика. The Complete Idiot`s Guide To Physics

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>45) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... The %if xxx conditionals are used to begin a section of the spec file that is specific to a particular architecture or operating system. ... If the build system's architecture is specified, the part of the spec file following the %ifarch , but before a %else or %endif will be used during the build. %ifarch i386 sparc . See also: the section called The %ifarch Conditional in Chapter 13 . ... An %endif is used to end a conditional block of spec file statements. ...

Еще в разделе: (Показать все результаты (>710) - uneex.lorien.cs.msu.su/ )

• HelpOnInstalling/ApacheOnWin32withDomainAuthentication - UNИX
• Platform-Dependent Conditionals

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2194) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Еще в разделе: (Показать все результаты (>158) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Departments
• Information for foreigners who wish to study at our Faculty

... Next: Reconstruction of 3D Images Up: Image Processing Previous: Linear spline Contents Index . The Commands presented in Operations Menu (all of them are also available by Clicking Right Mouse button on the image area) allows to obtain different information about the surface, add/subtract images, to present them in more clear form. ... Reconstruction of 3D Images . ... Next: Reconstruction of 3D Images Up: Image Processing Previous: Linear spline Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>184) - www.spm.genebee.msu.ru/ )

• Curves to section conversion
• Sensor with Remote Operation for Chemical and Biological Protection
• Scanning Probe Microscopy Image Processing Software User's Manual FemtoScan

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>171) - www.fadr.msu.ru/ )

The problems of high performance technologies for solving large sparse linear systems" . Il'in V.P. The technological problems of implementation of the parallel algorithms for solving the systems of linear algebraic equations with sparse matrices of high order that arise in grid approximations in the large problems of mathematical modeling are considered. ... PostScript (in Russian) (401KB) . PDF (in Russian) (195KB) . PostScript. zip (in Russian) (98.5KB) . ...

Еще в разделе: (Показать все результаты (>373) - num-meth.srcc.msu.ru/ )

• "Some technological aspects of GPGPU applications in applied program systems"
• "Screen video compression with a video card. Comparison of technologies"
• On acceleration technologies of parallel decomposition methods

... Карта сайта . ... Электронная библиотека . ... Издания библиотеки . ... Электронная библиотека / Электронная библиотека: Подписка БЕН РАН . ... USA . ... Journal of Colloid and Interface Science . ... Journal of Computational Physics . ... Journal of Molecular Biology . ... Journal of Molecular Spectroscopy . ... Journal of Parallel and Distributed Computing . ... Journal of Solid State Chemistry . ... Journal of Sound and Vibration . ... Journal of Geophysical Research. ... Biophysical Journal . ...

Еще в разделе: (Показать все результаты (>5403) - www.sevin.ru/ )

• Laboratories: Laboratory of Tropical Technologies: Results
• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Экологический Форум - Фундаментальная Экология: Over virtually the complete