A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>161) - www.fadr.msu.ru/ )

Электронная библиотека Попечительского совета . ... Bachman G. - Elements of Abstract Harmonic Analysis . ... Название: Elements of Abstract Harmonic Analysis . Автор: Bachman G. Аннотация: . Abstract Harmonic Analysis is an active branch of modern analysis which is increasing in importance as a standard course for the beginning graduate student. ... Generalized nilpotent element 57 . ... Nilpotent element 57 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>18575) - lib.mexmat.ru/ )

• Поиск книг, содержащих Полнота метода резолюции (completeness of resolution
• Bridges D.S. - Foundations Of Real And Abstract Analysis :: Электронная
• Loomis L.H. - An introduction to abstract harmonic analysis :: Электронная

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4512) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

... Navier-Stokes Based Models in Computational Aeroacoustics . ... The same high accuracy numerical scheme is proposed for the numerical implementation of all the models. It is illustrated that a good efficiency of predictions is provided not only by the scheme accuracy, but also by such computational properties as differential model accuracy and round off errors. The following particular aspects are discussed: the influence of nonlinear effects and the treatment of very small perturbations. ...

Еще в разделе: (Показать все результаты (>455) - acs366.phys.msu.su/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>29577) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 62e38970ffa2 lib/sequence.py

... Numeration assumed . For this study 36 PDB-entries containing coordinates of Homeodomains were used. ... Yes . ... Drosophila melanogaster . ... X-RAY . ... MAT a 1 . ... 182 . ... 151 . ... X-ray . ... According to the gaps present in the alignment, all chains were renumbered so that after each gap the numeration begins from a new number. Thus, all aligned residues of different structures go under the same number and the gaps in the alignment do not put the numeration out. ...

Еще в разделе: (Показать все результаты (>1283) - monkey.belozersky.msu.ru/ )

• ETS numeration assumed
• SCOP classification
• About this project

The analysis of the asymptotic behavior of Ornstein - Zernike equation shows that the phase transitions on binodal cannot exist in the standard theory, which accounts for the analytical solutions only. To obtain the transitions it is necessary to build the nonlinear theory. ... It allows one to describe the critical phenomena in complete agreement with the experimental data and with the scaling theory, as well as to explain the nature of the liquid - vapor phase transitions. ...

Еще в разделе: (Показать все результаты (>267) - polly.phys.msu.ru/ )

• Publication list, Olga Shamardina

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>1892) - chem.msu.ru/ )

• The Use of N,N-Bis(hydroxybenzyl)ethylenediamine-N,N-diacetic Acid (HBED) for
• Moscow University Chemistry Bulletin Vol. 44, No. 5, P. 295 (2003)
• Moscow University Chemistry Bulletin Vol. 42, No. 4, P. 247 (2001)

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Aloise S. , O?Keeffe P. , Cubaynes D. , Meyer M. , Grum-Grzhimailo A.N. в журнале Physical Review Letters , издательство American Physical Society (United States) , том 94, ? ... 2002 Strong, polarized Balmer-alpha fluorescence after resonant core excitation of HCl . ...

Еще в разделе: (Показать все результаты (>5725) - istina.msu.ru/ )

• Bonch-Osmolovskaya E.A. - сотрудник | ИСТИНА - Интеллектуальная Система
• Abstract and Applied Analysis - журнал | ИСТИНА - Интеллектуальная Система
• James D. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... We apply Multichannel Singular Spectrum Analysis (MSSA, or extended EOF) technique to filter GRACE data and separate the principal components (PCs) of different periods. We performed data averaging over the large river basins of Russia. ... In every point ij on the map we have time series Aij(tk) of length N. The trajectory matrix for every XAij should be build and incorporated into large block matrix X as follows: X Aij Aij (t0 ) Aij (t1 ) .. ... Sum of PCs 1-10 for particular rivers basins. ...

Еще в разделе: (Показать все результаты (>270) - lnfm1.sai.msu.ru/ )

• http://lnfm1.sai.msu.ru/~tempus/english/science/articles/ZotovPoster_APSG2013.pdf
• Speckle polarimeter
• Trudy GAISH, vol. LXV, 1996, Abstracts in English

... About lab . ... Video processing . ... Video-based tracking . ... Online Journal "Computer graphics and multimedia" (in russian) . ... MSU Codec Comparison aims to deliver high quality comparisons of video encoders to both industrial and scientific communities. ... Selected projects of Graphics & Media Lab - best publications and most prominent results. ... Video matting refers to a problem of accurate decomposition of given video sequence to background layer, foreground layer and transparency map. ...

Еще в разделе: (Показать все результаты (>365) - graphics.cs.msu.ru/ )

• Grants and contracts | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Video processing | Graphics and Media Lab

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>72) - brain.bio.msu.ru/ )

• Change-point detection algorithm performance with real EEG

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>501) - imaging.cmc.msu.ru/ )

• Image resampling and superresolution | Laboratory of Mathematical Methods of
• Publications | Laboratory of Mathematical Methods of Image Processing

Approximation of Abstract Differential Equations . ... This review paper is devoted to the numerical analysis of abstract differential equations in Banach spaces. Most of the finite difference, finite element, and projection methods can be considered from the point of view of general approximation schemes. ... The qualitative theory of differential equations in Banach spaces is presented in many brilliant papers and books. ...

Еще в разделе: (Показать все результаты (>195) - srcc.msu.ru/ )

• D.D.Sokoloff, Magnetic field reversals in a simple model of geodynamo, Problems
• Leading scientific fellow Sergey Piskarev Ph.D.

Network Working Group Request for Comments: 4794 Obsoletes: 1264 Category: Informational B. Fenner AT&T Labs - Research December 2006 RFC 1264 Is Obsolete Status of This Memo This memo provides information for the Internet community. ... Copyright Notice Copyright (C) The IETF Trust (2006). ... It prescribed rules to protect the Internet against new routing protocols that may have various undesirable properties. ... Fenner Informational [Page 1] RFC 4794 RFC 1264 Is Obsolete December 2006 1. ...

Еще в разделе: (Показать все результаты (>18872) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc4794.txt
• http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-eromenko-ipff-arp-00.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc6339.txt

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>355) - num-meth.srcc.msu.ru/ )

• "Methods of text fragment relevance estimation based on the topic model

... A Complete Solar Cycle from SOHO . ... Credit Copyright: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... A solar cycle is caused by the changing magnetic field of the Sun, and varies from solar maximum , when sunspot , coronal mass ejection , and flare phenomena are most frequent, to solar minimum, when such activity is relatively infrequent. ... Publications with words: solar cycle - solar maximum - SOHO . ... A Solar Prominence from SOHO ...

Еще в разделе: (Показать все результаты (>13241) - www.astronet.ru/ )

• Астронет > A Complete Solar Cycle from SOHO
• A Complete Aurora
• Астронет > A Complete Aurora

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>142) - sp.cs.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>343) - mccmb.belozersky.msu.ru/ )

• MCCMB'15