Электронная библиотека Попечительского совета . ... Hobby D., McKenzie R. - The Structure of Finite Algebras . ... Название: The Structure of Finite Algebras . Авторы: Hobby D., McKenzie R. Аннотация: . ... The main discovery presented here is that the lattice of congruences of a finite algebra is deeply connected to the structure of that algebra. ... Algebra 5 . Algebra, -minimal 34 . ... Locally finite algebra 14 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>27072) - lib.mexmat.ru/ )

• Niederreiter H. - Random number generation and quasi-Monte Carlo methods ::
• Robinson A. - Complete theories :: Электронная библиотека попечительского
• Brown M.C. - Perl: The Complete Reference :: Электронная библиотека

This is an experimental PWAD file for use with DOOM. It is rather simple since I cannot generate the nodes structure for anything much more complex than this. This level has been generated entirely by hand. ... I know it isn't much, but I released it just to be the producer of the first completely original WAD file! 8-) If anyone knows anything more about the NODES and SSECTORS data structure let me know. As soon as I know, I can start to produce a true level builder. ...

Еще в разделе: (Показать все результаты (>15465) - crydee.sai.msu.ru/ )

• Heliophysics, Internal structure and seismology

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3912) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>134) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• GML C++ Camera Calibration Toolbox | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>26) - cdfe.sinp.msu.ru/ )

... 20.09.2009 . ... Moscow Vyatichi, November 9 - 11, 2009. ... Opt., 2009, v. 11, 074008 . ... In this work we study sum-frequency generation from the surface of an isotropic chiral medium in arbitrary interaction geometry of the paraxial light beams at fundamental frequencies. ... Within the first-order approximation approach, generally, the polarization state of light is distributed inhomogeneously in the reflected signal beam cross section, and the transversal intensity distribution is not Gaussian...

Еще в разделе: (Показать все результаты (>755) - ilc.phys.msu.ru/ )

• Публикация

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>918) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Moscow University Chemistry Bulletin Vol. 48, No. 2, P. 86 (2007)
• Solvent effects on exciplex polarity

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>16721) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: 1e5116ce9d75 allpy/sequence.py
• allpy: 596bdc5897bf allpy/sequence.py

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>104) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

... Experimental Study of Sound Scattering by Vortex Rings . ... The paper presented deals with scattering of sound by vortex ring moving horizontally in a stratified liquid over the flow regimes from laminar to turbulent ones. ... According to experimental data, the ring is identified as an inhomogeneity with cross section of volume backscattering governed by internal microscale which is of an order of sound wave length. ... Section : 7 ...

Еще в разделе: (Показать все результаты (>619) - acs366.phys.msu.su/ )

• Schedule : Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth
• Schedule : Nonlinear Acoustics and Flows, Instabilities, Turbulence, and
• Nonlinear Acoustics and Flows, Instabilities, Turbulence, and Thermoacoustics

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>136) - bioinf.fbb.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:27 Sat , 04 Dec 2010 20:32:41 GMT darkhan [21:bb4a79cc6b6e] I don't understand... default mercurial: created new head, merged branch Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * ...

Еще в разделе: (Показать все результаты (>1389) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=22%3A749533cdfc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=c74a9885bf048a4938c290470e671c1c9c68dd33&limit=100&mode=stop_on_copy

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DiMMon: a New Approach to Supercomputer Monitoring . ... Kazan National Research Technological University . ... AREA: Physical Chemistry, Optics and Quantum Electronics . ... Moscow State Uiversity . DRIVER: Supercomputer-aided development of new mid-infrared laser technologies. ... AREA: Optics and Quantum Electronics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>41) - hpc.msu.ru/ )

• APPLICATIONS: Fundamental Medicine and Phisiology | Moscow University
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>151) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• Complete Savages - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

О лаборатории . ... Лаборатория теоретической биофизики . ... The script generates nanotubes of arbitrary structure. ... To use it, save script to some file, then load into PyMol with the command: run /path/to/script.py . ... Here comes the script : # Nanotubes generating script for PyMol by piton at erg .biophys.msu.ru import cmd from math import cos,sin,pi,ceil,floor, acos from chempy import models, cpv class cell: def __init__(self ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>38) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• toolset ERG Research Group: Лаборатория теоретической биофизики

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... TWiki ? TWikiUIViewDotPm . UI delegate for view function . ... view StaticMethod view ($session,$web,$topic,$scruptUrl,$query) . viewfile StaticMethod viewfile ($session,$web,$topic,$query) view command handler. This method is designed to be invoked via the TWiki::UI::run method. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiUIViewDotPm . ...

Еще в разделе: (Показать все результаты (>36015) - dualopt1.cmm.msu.ru/ )

• TWikiUIViewDotPm - TWiki - TWiki - (printable)
• %TOPICTITLE% (2 vs. 3) - TWiki
• %TOPICTITLE% (15 vs. 19) - TWiki

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>4828) - istina.msu.ru/ )

• International Journal of Foundations of Computer Science - журнал | ИСТИНА -
• Van Smaalen S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Tang S.H. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Generation of recombinant antibodies and means for increasing their affinity. ... For example, application of recombinant technologies resulted in antibody preparation of high affinity significantly exceeding the initial affinity of natural antibodies. In this review we summarize information about the structure, modes of preparation, and application of recombinant antibodies and their fragments and also consider the main approaches used to increase antibody affinity. ...

Еще в разделе: (Показать все результаты (>75) - biochem.bio.msu.ru/ )

• Quaternary structure of human small heat shock protein HSPB6 (Hsp20) in crowded
• Three-dimensional structure of alpha-crystallin domain dimers of human small
• Generation of superoxide by the mitochondrial Complex I.

... Common information . ... no information] . ... since 1900-01-01 till today . ... Elsevier Science . ... http://www.sciencedirect.com/science/.. ... 1982-01-01 . 2001-12-31 . ... full-text . http://www.sciencedirect.com/science/... 1995-01-01 . today . ... http://elibrary.ru/issues.asp?id=96 . ...

Еще в разделе: (Показать все результаты (>142) - journals.genebee.msu.ru/ )

Next: Kernel ipc_perm structure Up: Internal and User Data Previous: Kernel msg structure . ... one msqid structure for each queue on the system */ struct msqid_ds { struct ipc_perm msg _perm; struct msg * msg _first; /* first message on queue */ struct msg * msg _ last ; /* last message in queue */ time_t msg _stime; /* last msgsnd time */ time_t msg _rtime; /* last msgrcv time */ time_t msg _ctime; /* last change time */ ... msg_perm . ...

Еще в разделе: (Показать все результаты (>316) - itpm.msu.su/ )

• Subnetworks
• What is a Mail Message?
• Module Index - Apache HTTP Server