Электронная библиотека Попечительского совета . ... Duistermaat J.J, Kolk J.A.C. - Distributions: theory and applications . ... Название: Distributions: theory and applications . Авторы: Duistermaat J.J, Kolk J.A.C. Язык: . ... Complex-analytic family of distributions 124 . Complex-analytic function, distribution-valued 124 . ... Complex-differentiable distribution 113 . ... Convergence of distributions 43 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15913) - lib.mexmat.ru/ )

• Grenander U. - Toeplitz Forms and Their Applications :: Электронная библиотека
• Kakosyan A.V., Klebanov L.B., Melamed J.A. - Characterization of Distributions
• Billingsley P. - Probability and Measure :: Электронная библиотека

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>20) - antares.sinp.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>21) - cdfe.sinp.msu.ru/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>1917) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>166) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... Command Meanings IAC WILL TERMINAL-TYPE Sender is willing to send terminal type information in a subsequent sub-negotiation IAC WON'T TERMINAL-TYPE Sender refuses to send terminal type information IAC DO TERMINAL-TYPE Sender is willing to receive terminal type information in a subsequent sub-negotiation IAC DON'T TERMINAL-TYPE Sender refuses to accept terminal type information IAC SB TERMINAL-TYPE SEND IAC SE Sender requests receiver to transmit his (the receiver's) terminal type. ... IAC SE command...

Еще в разделе: (Показать все результаты (>47974) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc930.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc224.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc224.txt.pdf

... Non-destructive Test of status . ... This call is useful for accessing the information associated with a request, without freeing the request (in case the user is expected to access it later). ... MPI_REQUEST_GET_STATUS( request, flag, status ) . ... int MPI_Request_get_status(MPI_Request request, int *flag, MPI_Status *status) . MPI_REQUEST_GET_STATUS( REQUEST, FLAG, STATUS, IERROR) . ... Sets flag=true if the operation is complete, and, if so, returns in status the request status. ... Центры . ...

Еще в разделе: (Показать все результаты (>1279) - www.parallel.ru/ )

• MPI_Cancel | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Documentation | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Independence of Basic Runtime Routines | PARALLEL.RU -

... Unexpected Galaxy String in the Early Universe . ... 20.01.2004 . ... NSF , NASA Explanation: How could such a long string of galaxies form so early in the universe? Several new measurements of galaxies and clusters in the early universe are reporting structures involving galaxies and clusters that are larger than expected with the new standard "dark-energy" cosmology . ... Publications with keywords: galaxies - early universe . Publications with words: galaxies - early universe . ...

Еще в разделе: (Показать все результаты (>10718) - www.astronet.ru/ )

• Астронет > Unexpected Galaxy String in the Early Universe
• Supernova 1994D and the Unexpected Universe
• Астронет > Supernova 1994D and the Unexpected Universe

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>7563) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

Next: Building sendmail.cf Up: Installing sendmail Previous: Installing sendmail . First, you have to unpack the archive file in some safe location: . If you have a ``modern'' tar, for example from a recent Slackware Distribution, you can probably just do a tar -zxvf filename.tgz and get the same results. Unpacking the archive creates a directory named sendmail5.65b+IDA1.5+mailx5.3b. In this directory, you find a complete installation of sendmail+IDA plus a binary of the mailx user agent. ...

Еще в разделе: (Показать все результаты (>338) - itpm.msu.su/ )

• Mixing and Matching Binary Distributions
• Dialing out with chat
• The /usr filesystem

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2015 May 31 . Supernova 1994D and the Unexpected Universe . Image Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Long ago, far away, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... About APOD | ...

Еще в разделе: (Показать все результаты (>3263) - www.sai.msu.su/ )

• APOD: 2004 January 20 - Unexpected Galaxy String in the Early Universe
• SAL- Parallel Computing - Misc - Distributed GEANT
• APOD: 2009 September 8 - Unexpected Impact on Jupiter

... 2000 March 12 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured over the past few years have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD | ...

Еще в разделе: (Показать все результаты (>35) - www.arcetri.astro.it/ )

• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>151) - kinfo.ru/ )

• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>117) - phys.msu.ru/ )

• Title

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>474) - xray.sai.msu.ru/ )

• Amplitude Distribution
• Binary Pulsar Diversity and High Neutron Star Birth Velocity
• Spatial distribution of X-ray binaries at the Galactic center after the

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: 80,000 March, expected are (Rolex) times . ... a href=http://cheapisabels.zohosites.com/><b>isabel marant</b></a> Her 58 shows in Europe, the US, Canada, Mexico and South America played for a staggering 2,350,282 million fans and sold over (USD)280,000,000 in tickets.. ...

Еще в разделе: (Показать все результаты (>3921) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: hit supply prospects Expected
• Экологический Форум - Фундаментальная Экология: case. benefits Expected the buy
• Экологический Форум - Фундаментальная Экология: regulate concerns expected and

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... The program calculates the correlation between each pair of columns [ i, j ]: one from the proteins alignment, and the other from the site alignment. As a measure of correlation, the mutual information is used: . ... Arrays of 20 aminoacids and 4 nucleotides respectively. Observed frequency of aminoacid x being in position i and nucleotide y being in position j . ... Calculated as frequency of aminoacid x in column i multiplied by frequency of nucleotide y in column j . ...

Еще в разделе: (Показать все результаты (>9) - bioinf.fbb.msu.ru/ )

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>156) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1859) - www.fds-net.ru/ )

• Программисты шутят - Public forum of MSU united student networks