... Database: ss 272 sequences; 3,008,365 total letters Searching..................................................done Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome. (76 letters) Score E Sequences producing significant alignments: (bits) Value AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section .. ... Length = 7990 Score = 32.2 bits (16), Expect = 0.038 Identities = 19/20 (95%) Strand = Plus / Plus Query: 8 tagctcagttggtagagcgc 27 || ...

Еще в разделе: (Показать все результаты (>3368) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_Mb.txt
• http://kodomo.cmm.msu.ru/~pouliakhina/info/megablast1_res.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/megablastdis.out

Internet Engineering Task Force (IETF) Request for Comments: 5748 Category: Informational ISSN: 2070-1721 J. Jeong H. Kim H. Jeong Y. Won Korea Internet Security Agency August 2010 IANA Registry Update for Support of the SEED Cipher Algorithm in Multimedia Internet KEYing ( MIKEY ) Abstract This document updates IANA registries to support the ... Not all documents approved by the IESG are a candidate for any level of Internet Standard; see Section 2 of RFC 5741. ... SEED .. ...

Еще в разделе: (Показать все результаты (>17445) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5748.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5930.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5930.txt

... These functions all manipulate strings in various ways. ... bin2hex -- Convert binary data into hexadecimal representation . ... chr -- Return a specific character . ... convert_cyr_string -- Convert from one Cyrillic character set to another . count_chars -- Return information about characters used in a string . ... strncasecmp -- Binary safe case-insensitive string comparison of the first n characters . ... strncmp -- Binary safe string comparison of the first n characters . ...

Еще в разделе: (Показать все результаты (>502) - oit.cmc.msu.ru/ )

• Returning Values
• Array Functions

... unary minus) .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file .mysql_history file .pid (process ID) file . ... Arithmetic functions . ... Bit functions . ... Control flow functions . ... CREATE FUNCTION . CREATE INDEX . ... Date and time functions . ... DBI->{type} . ... DROP FUNCTION . DROP INDEX . ... MYSQL C type . ... MYSQL_FIELD C type . ... MYSQL_FIELD_OFFSET C type . ... MYSQL_RES C type . MYSQL_ROW C type . ... REVERSE() . ...

Еще в разделе: (Показать все результаты (>310) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - E Known errors and design
• Basic HTML data types

In Russian . ... Sections and Topics . ... Russian Visa . ... Moscow, June 27 - July 2, 2005 . theoretical problems and novel methods in phenomenological and statistical thermodynamics, thermodynamics of irreversible processes . ... teaching of chemical thermodynamics . ... Gorbenko , Moscow State University, Chemistry Department . ... Bulat R. Churagulov , Moscow State University, Chemistry Department . ... Vladimir A. Durov , Moscow State University, Chemistry Department . ...

Еще в разделе: (Показать все результаты (>239) - chem.msu.ru/ )

• Round Tables. Russian XV International conference on chemical thermodynamics

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>12777) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/hg/snake/raw-annotate/77dd3fe5a2d4/main.py

This is an implementation of RD-tree data structure using GiST interface of PostgreSQL. ... desc') - sort intarray test =# select sort ('{1,2,3}':: int [],'desc'); sort --------- {3,2,1} (1 row) int [] sort ( int []) - sort in ascending order int [] sort _asc( int []), sort _desc( int []) - shortcuts for sort int [] uniq( int []) - returns unique elements test =# select uniq( sort ('{1,2,3,2,1}':: int [])); uniq --------- {1,2,3} (1 row) int idx( ...

Еще в разделе: (Показать все результаты (>1492) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Discrete Methods Related Tools - Analysis Tool for
• Zen: intarray
• SAL- Other Scientific Fields - Artificial Intelligence - NEURON

... Return status . ... However, this information is not directly available as a field of the status variable and a call to MPI_GET_COUNT is required to ``decode'' this information. MPI_GET_COUNT(status, datatype, count) . ... int MPI_Get_count(MPI_Status *status, MPI_Datatype datatype, int *count) . ... All send and receive operations use the buf, count, datatype, source, dest, tag, comm and status arguments in the same way as the blocking MPI_SEND and MPI_RECV operations described in this section. ...

Еще в разделе: (Показать все результаты (>518) - www.parallel.ru/ )

• Message data | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Derived datatypes | PARALLEL.RU - Информационно-аналитический центр по
• Data Access with Explicit Offsets | PARALLEL.RU - Информационно-аналитический

... Sections . ... Division of Exhibition . ... Results of 2012 . ... Section staff . History of the Section . ... History of museum . ... Collections . ... Amphibians Reptiles collections . ... Schemes of the museum halls . ... Exhibition of Reptiles . ... The grey monitor lizard . ... Exhibition of Insects Exhibition of Invertebrates Exhibition of Fish Exhibition of Amphibians Exhibition of Reptiles Exhibition of Oceanic Hydrothermal The Scientific Terrarium The Circle of Young Naturalists . ...

Еще в разделе: (Показать все результаты (>1135) - zmmu.msu.ru/ )

• Section staff
• History of the Section
• Monitoring of common birds

... Acousto-Optic Cells with Non-Uniform Length of Light and Sound Interaction . ... The paper examines operation of acousto-optic cells designed with cross section of acoustic columns different from the traditional rectangular form. ... It is evident that application of the ? transducers possessing the complicated shape of the electrodes results in unequal lengths of light and sound interaction over cross section of an incident optical beam. ... Section : 9 ...

Еще в разделе: (Показать все результаты (>413) - acs366.phys.msu.su/ )

• ABSTRACTS BY SECTIONS

МГУ имени М.В.Ломоносова Русская версия . ... 29 Feb 2016 . ... Prof., Dept. of Internal Medicine; . Akopian Vladimir Sergeyevich, Sci.D., Prof., Dept. of Ophthalmology, Head; . Arkhipenko Yury Vladimirovich, Sci.D., Prof., Adaptive Medicine Laboratory, Head; . Baranov Anatoly Petrovich, Sci.D., Prof., Dept. of Therapy, Head; . Buravkov Sergey Valentinovich, Sci.D., Prof., Dept. of Ecological and Emergency Medicine; . ... Dubrov Vadim Erikovich, Sci.D., Prof., Dept. of Surgery, Head; . ...

Еще в разделе: (Показать все результаты (>44) - conf.msu.ru/ )

OStability of Bars with Variable Rigidity / Gorbachev V.I., Moskalenko O.B. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>69) - vestnik.math.msu.su/ )

by Margarita Dzhalalova It is known that the pressure difference values for a round parachute are constant over total canopy, then for a square parachute the values of pressure difference are non-uniform along radial ribbons differing even from each other and depending mainly on certain sets of line lengths, and therefore square parachutes attain different shapes from each other ( Fig.1 - photo of var.1 and var.2). ... Distribution of pressure coefficient along radial ribbons of square parachute. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization
• On Square Parachute Differential Equations

... This program was created for correlating chosen regions in the series of fts images. ... Chosen regions' . ... In this section the program counts the integral for each region of the grid for each image. ... As a matter of fact, the integral is total brightness of the region and it is counted by 'int_tabulated' IDL function. ... In addition, the program will show the count of the regions which correlate with the corresponding region (the brighter region means the bigger count) and its contour. ...

Еще в разделе: (Показать все результаты (>152) - lnfm1.sai.msu.ru/ )

... A , NUCLEAR INSTRUMENTS & METHODS IN PHYSICS RESEARCH SECTION A-ACCELERATORS SPECTROMETERS DETECTORS AND ASSOCIATED EQUIPMENT , Nucl. ... Section A , Nucl.Instrum.Meth.A , Nuclear Inst and Method. ... Section A: Accelerators, Spectrometers, Detectors and Associated Equipment , Nuclear Instruments and Methods in Physics Research.A , Nuclear instruments & methods in physics research. Section A, Accelerators, spectrometers, detectors and associated equipment . ...

Еще в разделе: (Показать все результаты (>1489) - istina.msu.ru/ )

• Nuclear Instruments and Methods in Physics Research, Section B: Beam
• Acta Crystallographica Section E: Structure Reports Online - журнал | ИСТИНА -
• Acta Crystallographica Section C: Crystal Structure Communications - журнал |

Электронная библиотека Попечительского совета . ... Jerrum M. - Counting, sampling and integrating: algorithms and complexity . ... Название: Counting, sampling and integrating: algorithms and complexity . Автор: Jerrum M. Аннотация: . The subject of these notes is counting (of combinatorial structures) and related topics, viewed from a computational perspective. ... Almost uniform sampler 27 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8973) - lib.mexmat.ru/ )

• Bubley R. - Randomized algorithms: approximation, generation, and counting ::
• Sinclair A. - Algorithms for Random Generation and Counting: A Markov Chain
• Graver J.E. - Counting on Frameworks: Mathematics to Aid the Design of Rigid

... Figure 3.6: Construction of Sections. ... To fulfill the procedure click the left button of the mouse at the point which will be starting on, and continuing pressing the button draw the section line. The section line and the window with the image of the profile across the section line will appear after the release of the button (fig. ... To achieve this put a tick against option Spectrum in the Menu View when the section window is active. ... With the second one section width remains constant. ...

Еще в разделе: (Показать все результаты (>69) - www.spm.genebee.msu.ru/ )

• COM-port initialization file format
• Column Selection
• Line Selection

The sections <Directory> , <Location> and <Files> can contain directives which only apply to specified directories, URLs or files respectively. Also htaccess files can be used inside a directory to apply directives to that directory. ... The order of merging is: . ... If multiple <Directory> sections apply to the same directory they are processed in the configuration file order. ... Using the options in question is only possible inside a <Directory> section (or a .htaccess file). ...

Еще в разделе: (Показать все результаты (>72) - neptun.sai.msu.ru/ )

• Manual Page: htpasswd - Apache HTTP Server

... Section boundaries are defined with %STARTSECTION{}% and %ENDSECTION{}% . Sections may be given a name to help identify them, and/or a type, which changes how they are used. ... type="section" - the default, used for a generic section, such as a named section used by INCLUDE . ... section" . ... Sections may be given a name to help identify them, and/or a type, which changes how they are used. type="section" - the default, used for a generic section, such as a named section used by INCLUDE . ...

Еще в разделе: (Показать все результаты (>32371) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (2 vs. 3) - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki
• %TOPICTITLE% (3 vs. 4) - TWiki

. information . decision . totals . citations . photos . sitemap . program . abstracts . sections . participants . seminars . round tables . in Russian . Please, use the Russian version of this page for more information: www.philol.msu.ru/~rlc2004/ru/totals/ . information . decision . totals . citations . photos . sitemap . program . abstracts . sections . participants . seminars . round tables . in Russian . телефон/факс: (095) 939-31-78 . Электронная почта:

Еще в разделе: (Показать все результаты (>154) - www.philol.msu.ru/ )

• II International Congress of Russian Language Researches