... These functions all manipulate strings in various ways. ... bin2hex -- Convert binary data into hexadecimal representation . ... chr -- Return a specific character . ... convert_cyr_string -- Convert from one Cyrillic character set to another . count_chars -- Return information about characters used in a string . ... strncasecmp -- Binary safe case-insensitive string comparison of the first n characters . ... strncmp -- Binary safe string comparison of the first n characters . ...

Еще в разделе: (Показать все результаты (>484) - oit.cmc.msu.ru/ )

Электронная библиотека Попечительского совета . ... Mangano S. - XSLT Cookbook . ... Название: XSLT Cookbook . ... The 136 solutions to commons problems address string processing, mathematics, dates and times, document traversal, XML queries, HTML, scalable vector graphics, code generation, debugging, and generic programming. ... automation, code generation, XSLT from XSLT . ... Code . ... code, generation, XSLT from XSLT . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8794) - lib.mexmat.ru/ )

... Parsimony method . ... It is based on the following principle: the ancestral sequences (posed in nodes of a phylogenetic tree) should be such that the minimal required number of character replacements on the branches of the tree is less than for any other choice of sequences. ... If the preliminary character of the node is * , but the output character of its immediate ancestor is some letter (say, X ), and its set of possible characters contains X , then the output character of the node is also X . ...

Еще в разделе: (Показать все результаты (>5457) - monkey.belozersky.msu.ru/ )

... Content Model: subset of %text (see DTD for details) . Preformatted text between the start and end PRE tag is rendered using a fixed with font, in addition whitespace characters are treated literally. The spacing and line breaks are rendered directly, unlike other elements, for which repeated whitespace chararacters are collapsed to a single space character and line breaks introduced automatically. Line breaks within the text are rendered as a move to the beginning of the next line. ...

Еще в разделе: (Показать все результаты (>174) - comet.sai.msu.ru/ )

• Using regular expressions with the grep command

Calculations of interactions in biomolecular systems: comparison of quantum and classical approaches" . Bazhanova Z.G., Khrenova M.G., Nemukhin A.V. Methodical aspects of molecular mechanics, quantum chemistry, and combined quantum mechanics/molecular mechanics (QM/MM) approaches are discussed with respect to the intermolecular interaction calculations between some aminoacids (arginine, histidine, and serine) and water molecules. ... PostScript (in Russian) (1.28MB) . ...

Еще в разделе: (Показать все результаты (>439) - num-meth.srcc.msu.ru/ )

• "Comparison of the Verlet table and cell-linked list algorithms for sequential,
• "Stabilization of computational algorithms for the characterization of thin
• "An algorithm for calculating the equilibrium state of a ferromagnetic by the

XLOGP/PLOGP . Partition coefficient in octanol/water (logP) has long been used to parameterizing the hydrophobicity character in QSAR studies. XLOGP is a method which can calculate the logP value for an organic compound from its topological structure. ... The first part, plogp, calculates the 1-octonal/water partition coefficients of short peptides. ... http://mdl.ipc.pku.edu.cn/drug_design/work/xlogp.html . ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ...

Еще в разделе: (Показать все результаты (>1453) - www.sai.msu.su/ )

• Zen: SkyPixelization

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>293) - graphics.cs.msu.ru/ )

• Video Frame Rate Double Up-Conversion | Graphics and Media Lab
• Video Frame Rate N-Times Up-Conversion | Лаборатория компьютерной графики и
• Video Frame Rate N-Times Up-Conversion | Graphics and Media Lab

... Plugin Installation Instructions . ... WikiRing Consultants This plugin will help you to write readable markup (TWikiMarkup, HMTL, ...) within TWiki by allowing tags and arguments to be formatted on multiple lines. ... Basically, there are two ways of glueing and recombining lines by either removing all whitespaces between two lines using %*~~ or by removing all whitespaces and separateing lines with a single space using %~~~ . ... lib/TWiki/Plugins/GluePlugin.pm . ... TWiki:Plugins/GluePlugin . ...

Еще в разделе: (Показать все результаты (>35040) - dualopt1.cmm.msu.ru/ )

• RegularExpression - TWiki - TWiki
• %TOPICTITLE% (1 vs. 2) - TWiki
• %TOPICTITLE% (2 vs. 3) - TWiki

CompHEP was created as a program for calculation in the interactive regime. ... Due to this circumstance we have implemented the batch (or, say, `blind') calculation mode into CompHEP. If one launches s_comphep with an option "-blind", e.g. $COMPHEP/s_comphep -blind STRING . ... Right Arrow . ... So, the user has a possibility to concatenate into STRING a list of commands which simulate the keyboard and execute s_comphep in the non-interactive mode. ... COMPHEP/s_comphep -blind "]}}]]]}9" . ...

Еще в разделе: (Показать все результаты (>1582) - theory.sinp.msu.ru/ )

• CompHEP
• VEGAS menu
• Batch calculations

... D.1 Grammar . ... D.3 Comparison of tokenization in CSS2 and CSS1 . This appendix is normative. ... STRING ] S* ]? ']' ; pseudo : ':' [ IDENT | ... LENGTH S* | ... return CDC;} ~= { return INCLUDES;} |= { return DASHMATCH;} { string } { return STRING ;} { ident } { return IDENT ;} # {name} { return HASH;} @import { return IMPORT_SYM;} @page { return PAGE_SYM;} @media { return MEDIA_SYM;} @font-face { return FONT_FACE_SYM;} @charset { return CHARSET_SYM;} @ { ...

Еще в разделе: (Показать все результаты (>1358) - crydee.sai.msu.ru/ )

• ASA Carriage Control Characters
• Introduction
• Long description of example of cell background calculation

... The evolution of a binary system is considered as a sequence of stages the duration of which are defined by the shortest evolutionary time-scale of one of the binary components (see the list of the evolutionary states of stars in Sections 3 and 4). ... Then the code finds a new stage the binary should transit to, with this stage being determined by the evolutionary states of both components, and calculates it. ... However, one can use the algorithm described above to model their evolution. ...

Еще в разделе: (Показать все результаты (>320) - xray.sai.msu.ru/ )

• The COOC Criterion (Criterion of Observations versus Calculations)
• Effect of sources evolution on
• Principles of Scenario Machine Operation

Previous article . Next article . ... The number of generators of a crystallographic space group . ... of a minimal generator set of a space group G , a numeric parameter Q called critical coordination number was constructed. ... was calculated for trimetric space groups. ... Moscow University Chemistry Bulletin . 2012, Vol. ... Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>605) - chem.msu.ru/ )

• Conjunction of thermal lens spectrometry and high-performance liquid
• Moscow University Chemistry Bulletin Vol. 44, No. 1, P. 92 (2003)
• Moscow University Chemistry Bulletin Vol. 43, No. 3, P. 139 (2002)

... Comparison of soluble and placental transferrin receptors as standards for the determination of soluble transferrin receptor in humans. ... 1500 kDa, whereas the MW of sTfR corresponded to 237 kDa. ... The serum sTfR levels calculated against sTfR were 2.5 times lower than those calculated against pTfR. Serum sTfR levels are overestimated when pTfR is used as the standard. ...

Еще в разделе: (Показать все результаты (>34) - biochem.bio.msu.ru/ )

• Biochemical characterization of small heat shock protein HspB8 (Hsp22)-Bag3

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>83) - selena.sai.msu.ru/ )

... The Document Character Set . ... The SGML Declaration . The HTML 4.0 document character set, in the SGML sense, is the Universal Character Set (UCS) of [ISO10646] . ... After compression the resultant file sizes are close to that for character encodings such as ISO-8859-1 and EUC-JP. ... SGML "ISO 8879:1986" -- SGML Declaration for HyperText Markup Language version 4.0 With support for Unicode UCS-4 and increased limits for tag and literal lengths etc. ...

Еще в разделе: (Показать все результаты (>230) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - H Description of MySQL
• mod_charset_lite - Apache HTTP Server
• HTML Document Character Set

T. V. Amotchkina, M. K. Trubetskov, V. Pervak, S. Schlichting, H. Ehlers, D. Ristau, and A. V. Tikhonravov, Comparison of algorithms used for optical characterization of multilayer optical coatings // Appl. ... 3389-3395 . ... Ключевые слова: Design, optical monitoring, characterization ...

Еще в разделе: (Показать все результаты (>89) - srcc.msu.ru/ )

• Arushanyan O.B., Volchenskova N.I., Zaletkin S.F. Calculation of expansion
• T. V. Amotchkina, M. K. Trubetskov, A. V. Tikhonravov, V. Janicki, J.
• Rafaeva, Anna. Motives and Characters in Folklore Indices and Russian Folktales

This page briefly describes the texture filtering modes implemented in the current release of PolyWorld Engine. The following is a sample MIP-map texture generated from a regular 256x256 texture map. ... This map is usually referred to as a 4D Pyramid Anisotropic Filtering map. Only one, isotropic integer MIP level is calculated (MIP u = MIP v ). ... Unlike the Bilinear Filtering case shown above, rational isotropic MIP level is calculated . ... color = lrp (color1, color2, frc_MIP); . ...

Еще в разделе: (Показать все результаты (>18) - www.kge.msu.ru/ )

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>140) - bioinf.fbb.msu.ru/ )

• SDPlight
• Algorithm
• SDPpred

... Structural modeling of PPI (protein docking) can be roughly divided into: (i) free docking, where sampling of the binding modes is performed regardless of the possible existence of similar experimentally determined structures, and (ii) template-based or comparative docking, where such similar complexes (templates) determine docking predictions. ... 2006) A new measure for functional similarity of gene products based on Gene Ontology, BMC Bioinformatics, 7:302. ...

Еще в разделе: (Показать все результаты (>228) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/49.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods