... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>92) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Traffic sign recognition | Graphics and Media Lab
• Grants and contracts | Graphics and Media Lab

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>78) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Filename completion with the TC shell
• Filename completion with the Bourne Again SHell

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>15238) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/m-o/origwad.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1

Электронная библиотека Попечительского совета . ... Smullyan R.M. - Recursion Theory for Metamathematics . ... Название: Recursion Theory for Metamathematics . Автор: Smullyan R.M. Аннотация: . ... The book deals mainly with those aspects of recursion theory that have applications to the metamathematics of incompleteness, undecidability, and related topics. ... Bar symmetric recursion theorem 116 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>9606) - lib.mexmat.ru/ )

• Поиск книг, содержащих Complete graph :: Электронная библиотека попечительского
• Stenstroem B. - Ring of quotients. Introduction to methods of ring theory ::
• Goleniewski L., Jarrett K.W. - Telecommunications Essentials: The Complete

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2846) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

log . ... file . ... file log . ... find changesets by author, revision, files, or words in the commit message . ... author . ... Tue, 23 Nov 2010 16:26:14 +0300 . ... 3 # Compiler - generated junk . ... 7 # Junk from text - editors . ... 11 # Temporary files from debianization . 12 debian /python-allpy/ . 13 debian /geometrical-core/ . 14 debian /*.substvars . 15 debian/*.debhelper* . 16 debian/*stamp* . 17 debian/files . 18 debian/control . 19 debian/*.log . ...

Еще в разделе: (Показать все результаты (>8797) - kodomo.fbb.msu.ru/ )

• allpy: 1e5116ce9d75 .hgignore
• allpy: .hgignore annotate
• allpy: log

Network Working Group Request for Comments: 225 NIC 7624 Category: D.6 Updates: RFC #74 E. Harslem Rand UCSB 13 September 1971 RAND/UCSB NETWORK GRAPHICS EXPERIMENT INTRODUCTION During the Network Graphics Meeting in July, several experiments were outlined to explore graphics over the Network. ... Stoughton [Page 1] RFC 225 RAND/UCSB NETWORK GRAPHICS EXPERIMENT September 1971 Input to the OLS was done via a Rand tablet on a VGS console. ... UCSB OLS INIT STATS | ... Dis| | ... UCSB OLS CONNECTED | ...

Еще в разделе: (Показать все результаты (>17677) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc225.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc131.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc131.txt

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>112) - nuclphys.sinp.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:14 Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * Interface.py ( modified ) little corrections Sat , 04 Dec 2010 19:42:50 GMT is_rusinov [18:d2705c3ee7a7] * ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=19%3A3d1a72f49417&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>37) - angel.cs.msu.su/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>912) - theory.sinp.msu.ru/ )

• [Comphep-common] Events to produce of LHAEF format
• [Comphep-common] Re: $COMPHEP/genEvents
• The RU-NGI Third quarter 2011 Archive by thread

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... О UNИX . ... 07_UsingIPTables . ... базовые функции, классификация . ... +проброс порта): [root@srv ~]# iptables-save # Generated by iptables-save v1.4.18 on Fri Apr 4 14:38:01 2014 *mangle :PREROUTING ACCEPT [27:2118] : INPUT ACCEPT [27:2118] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [20:2782] :POSTROUTING ACCEPT [20:2782] COMMIT # Completed on Fri Apr 4 14:38:01 2014 # Generated by iptables-save v1.4.18 on Fri Apr 4 14:38:01 2014 *nat :PREROUTING ACCEPT [0:0] : INPUT ACCEPT [0:0] ...

Еще в разделе: (Показать все результаты (>738) - uneex.lorien.cs.msu.su/ )

• Getting Ready to Sign
• PspoClasses/080708/01IptablesTheory - UNИX
• Module Index - Apache HTTP Server

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>491) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>158) - mccmb.belozersky.msu.ru/ )

.

17. Apache module mod_dir

18. Apache module mod_dir

19. Title

20. Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru