Astronomy Picture of the Day . A Brighter Comet LINEAR . ... 25.06.2001 . ... This delightful telescopic picture of the brighter coma of comet LINEAR was recorded from Australia on June 20. ... June 2001 . ... NASA Web Site Statements, Warnings, and Disclaimers . ... U. Based on Astronomy Picture Of the Day . Publications with keywords: comet - Coma Cluster - C/2001 A2 - comet linear . Publications with words: comet - Coma Cluster - C/2001 A2 - comet linear . ... Comets and Bright Star . ...

Еще в разделе: (Показать все результаты (>72988) - www.astronet.ru/ )

• Астронет > A Brighter Comet LINEAR
• Introducing Comet Lee
• Journal "Peremennye Zvezdy"

... 2001 June 25 . A Brighter Comet LINEAR . ... Explanation: Brighter than ever expected , comet LINEAR -- you know , the one designated C/2001 A2 -- is a sight to see in southern skies. This comet LINEAR first brightened impressively in late March as its active nucleus began to fragment , prompting some speculation that the comet might soon break up completely. ... This delightful telescopic picture of the brighter coma of comet LINEAR was recorded from Australia on June 20. ... About APOD | ...

Еще в разделе: (Показать все результаты (>8867) - www.sai.msu.su/ )

• APOD: 2006 March 6 - Unexpected Comet Pojmanski Now Visible
• APOD: April 27, 1999 - Introducing Comet Lee
• APOD: 2015 May 31 - Supernova 1994D and the Unexpected Universe

... December 30, 1998 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured in 1998 have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 March 12 - Supernova 1994D and the Unexpected Universe

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>16) - cdfe.sinp.msu.ru/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>1773) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>192) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>5540) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

This page is devoted to information on Supernova 1999dq in NGC 976 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main supernova page. Information on the original web pages for many of these images can be found on the Supernova links web page. Supernova 1999dq is the 24th LOSS discovery this year. ... VSNET Light curve (requires JAVA). ... vsnet-alert 3442 ] SNe 1999dp and 1999dq . vsnet-chat 2285 ] Host galaxy of SN1999dq . ...

Еще в разделе: (Показать все результаты (>471) - www.rochesterastronomy.org/ )

• Supernova 2001C in PGC 19975
• Supernova 1999ev in NGC 4274
• Supernova 1999ee and 1999ex in IC 5179

Электронная библиотека Попечительского совета . ... Friberg J. - Unexpected Links Between Egyptian And Babylonian Mathematics . ... Название: Unexpected Links Between Egyptian And Babylonian Mathematics . ... Mesopotamian mathematics is known from a great number of cuneiform texts, most of them Old Babylonian, some Late Babylonian or pre-Old-Babylonian, and has been intensively studied during the last couple of decades. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>14173) - lib.mexmat.ru/ )

• Поиск книг, содержащих 'Математические досуги' (The Unexpected Hanging and
• Поиск книг, содержащих Математическое ожидание (expectation или expected value)
• Поиск книг, содержащих Expected running time :: Электронная библиотека

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>310) - kinfo.ru/ )

• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

... Non-destructive Test of status . ... This call is useful for accessing the information associated with a request, without freeing the request (in case the user is expected to access it later). ... MPI_REQUEST_GET_STATUS( request, flag, status ) . ... int MPI_Request_get_status(MPI_Request request, int *flag, MPI_Status *status) . MPI_REQUEST_GET_STATUS( REQUEST, FLAG, STATUS, IERROR) . ... Sets flag=true if the operation is complete, and, if so, returns in status the request status. ... Центры . ...

Еще в разделе: (Показать все результаты (>458) - www.parallel.ru/ )

• MPI_Cancel | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Independence of Basic Runtime Routines | PARALLEL.RU -
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>314) - xray.sai.msu.ru/ )

• Science with CXO

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: 80,000 March, expected are (Rolex) times . ... a href=http://cheapisabels.zohosites.com/><b>isabel marant</b></a> Her 58 shows in Europe, the US, Canada, Mexico and South America played for a staggering 2,350,282 million fans and sold over (USD)280,000,000 in tickets.. ...

Еще в разделе: (Показать все результаты (>4048) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: regulate concerns expected and
• Экологический Форум - Фундаментальная Экология: hit supply prospects Expected
• Экологический Форум - Фундаментальная Экология: to expected information exotic

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... intas:cern-intas03:task2 ]] . ... T2.GRID monitor.. ... User Policy . ... GRID monitoring tools . ... Creation of a tool providing users with access to detailed application information in the framework of the GRID paradigm and test it in LCG. ... Development of monitoring tools that produce integrated characteristics by use of statistical information gathered from various GRID elements. ... However, the delivery of such specific information to users through the GRID is not possible in existing GRIDs...

Еще в разделе: (Показать все результаты (>729) - theory.sinp.msu.ru/ )

• intas:cern-intas03:task3 [THEP]
• intas:cern-intas03:task4 [THEP]
• тЬО intas:cern-intas03:task2 [THEP]

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>2512) - www.fds-net.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1575) - www.snto-msu.net/ )

• [php] "Unexpected $end" - не могу понять что за ошибка - Public forum of MSU
• wine 1.0 released - Public forum of MSU united student networks

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>3977) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/a-c/cerberus.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/d-f/fy1a.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/m-o/marble1.txt

Alex McKenzie Request for Comments #224 BBN NIC #7623 14 September 1971 Categories: D.7 Updates: none Obsoletes: none Reference: RFC #215, #221 Comments on Mailbox Protocol It should be noted that the Terminal IMP will be unable to directly implement the currently-proposed mailbox protocol for the following reasons: a) The Terminal IMP is completely incapable of storing incoming messages for later printing or display. b) The ...

Еще в разделе: (Показать все результаты (>16750) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc224.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc930.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc855.txt.pdf

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>240) - itpm.msu.su/ )

• The Login Chat