... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2074) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_Mb.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>17) - cdfe.sinp.msu.ru/ )

Электронная библиотека Попечительского совета . ... Friberg J. - Unexpected Links Between Egyptian And Babylonian Mathematics . ... Название: Unexpected Links Between Egyptian And Babylonian Mathematics . ... Mesopotamian mathematics is known from a great number of cuneiform texts, most of them Old Babylonian, some Late Babylonian or pre-Old-Babylonian, and has been intensively studied during the last couple of decades. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>21523) - lib.mexmat.ru/ )

• Sakawa M. - Genetic algorithms and fuzzy multiobjective optimization ::
• Поиск книг, содержащих Expected running time :: Электронная библиотека
• Good I.J. - Information, Weight of Evidence. the Singularity Between

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>13424) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

Astronomy Picture of the Day . ... 6.03.2006 . ... Right now, however, a new comet has brightened unexpectedly and is visible as a faint streak to the unaided northern observer in the eastern morning sky just before sunrise. ... Comet Pojmanski , officially designated C/2006 A1 and discovered only in January, now sports a turquoise tail several times longer than the full moon. ... March 2006 . ... Publications with keywords: comet - comet tail . Publications with words: comet - comet tail . ...

Еще в разделе: (Показать все результаты (>6401) - www.astronet.ru/ )

• Астронет > Z Machine Sets Unexpected Earth Temperature Record
• Z Machine Sets Unexpected Earth Temperature Record
• Unexpected X-rays from Comet Hyakutake

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>194) - kinfo.ru/ )

• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... intas:cern-intas03:task2 ]] . ... T2.GRID monitor.. ... User Policy . ... GRID monitoring tools . ... Creation of a tool providing users with access to detailed application information in the framework of the GRID paradigm and test it in LCG. ... Development of monitoring tools that produce integrated characteristics by use of statistical information gathered from various GRID elements. ... However, the delivery of such specific information to users through the GRID is not possible in existing GRIDs...

Еще в разделе: (Показать все результаты (>868) - theory.sinp.msu.ru/ )

• intas:cern-intas03:task3 [THEP]
• тЬО intas:cern-intas03:task2 [THEP]
• intas:cern-intas03:task4 [THEP]

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>153) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1853) - www.fds-net.ru/ )

... 2000 March 12 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured over the past few years have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD | ...

Еще в разделе: (Показать все результаты (>22) - www.arcetri.astro.it/ )

• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe

Network Working Group Request for Comments #224 NIC #7623 Categories: D.7 Updates: none Obsoletes: none Reference: RFC #215, #221 Alex McKenzie BBN 14 September 1971 Comments on Mailbox Protocol It should be noted that the Terminal IMP will be unable to directly implement the currently-proposed mailbox protocol for the following reasons: a) The Terminal IMP is completely incapable of storing incoming messages for later printing or display. ... It is _not_ likely to support the File Transfer Protocol. ...

Еще в разделе: (Показать все результаты (>17634) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc224.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc930.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc884.txt

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>344) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab
• Medical image analysis | Graphics and Media Lab

Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>306) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/138.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/8.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/40.pdf

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>266) - itpm.msu.su/ )

• The Login Chat

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>130) - sp.cs.msu.ru/ )

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf

Главная Программа Материалы - Конспекты - Задачи Электрожурнал Успеваемость Преподавателям . ... Identifier expected . ... Error in real constant . ... Error in integer constant . ... Возможно, отсутствует кавычка в конце строковой константы. ... Invalid filename . ... Integer constant expected . ... Integer or real constant expected . ... BEGIN expected . ... Integer expression expected . ... Integer or real expression expected . ... Integer variable expected . ... Integer or real variable expected . ...

19. http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/a-c/cerberus.txt

20. http://qfthep.sinp.msu.ru/talks/Atlas_Prospects_2010_2011QFTHEP_Maleev_final1.pdf