... Methone: Smooth Egg Moon of Saturn . ... Credit Copyright: Cassini Imaging Team , ISS , JPL , ESA , NASA Explanation: Why is this moon shaped like a smooth egg? The robotic Cassini spacecraft completed the first flyby ever of Saturn's small moon Methone in May and discovered that the moon has no obvious craters. ... NASA Official: Jay Norris. ... Publications with keywords: Saturn's Moon . Publications with words: Saturn's Moon . ... Six Moons of Saturn . ... Saturns Iapetus: Painted Moon . ...

Еще в разделе: (Показать все результаты (>74737) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Saturn's Moon Tethys
• Saturns Moon Tethys

... November 24, 1995 . Saturn's Moon Tethys . Credit: NASA , Voyager 2, Copyright Calvin J. Hamilton . Explanation: Tethys is one of the larger and closer moons of Saturn . ... Tethys is now known to be composed almost completely of water ice. Tethys shows a large impact crater that nearly circles the planet. That the impact that caused this crater did not disrupt the moon is taken as evidence that Tethys was not completely frozen in its past. ... About APOD | ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>9109) - www.sai.msu.su/ )

• APOD: 2003 November 21 - Sunset Moonlight
• APOD: November 5, 1999 - Shadow Of Phobos
• APOD: 2012 November 11 - Bailys Beads near Solar Eclipse Totality

... November 12, 1996 . Comet Hale-Bopp Passes M14 . ... Explanation : Comet Hale-Bopp continues its slow trek across the night sky, and can now be seen superposed near the bright globular cluster M14 . Will Comet Hale-Bopp become as bright in early 1997 as Comet Hyakutake did in early 1996? It is still too early to tell. ... Because of the size of coma , some speculate that the nucleus of Hale-Bopp is unusually large. ... Tomorrow's picture: Seven Jets from Comet Hale-Bopp . ... About APOD . ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: November 9, 1999 - Spiral Galaxies in Collision
• APOD: November 19, 1999 - Mercury And The Sun
• APOD: November 30, 1999 - Henize 70: A Superbubble in the LMC

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>86) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>93) - www.kosmofizika.ru/ )

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>147) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Filename completion with the TC shell
• Filename completion with the Bourne Again SHell

In Russian . ... Awards . ... Hot News . ... Moscow, June 27 - July 2, 2005 . ... The Final Conference Program is published on the web site . ... Awards Committee of the IACT has completed its work to select two winners for the "IACT Doctoral Awards, sponsored by Elsevier" . ... The Selection Committee for the IACT Awards is approved . ... International Association of Chemical Thermodynamics (IACT) have established two awards for young scientists : " IACT Doctoral Awards, sponsored by Elsevier " . ...

Еще в разделе: (Показать все результаты (>246) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron

... Communication Completion . ... MPI_REQUEST_NULL. ... A empty status is a status which is set to return tag = MPI_ANY_TAG, source = MPI_ANY_SOURCE, and is also internally configured so that calls to MPI_GET_COUNT and MPI_GET_ELEMENTS return count = 0. ... INTEGER REQUEST, STATUS(MPI_STATUS_SIZE), IERROR . ... Once a request is freed by a call to MPI_REQUEST_FREE, it is not possible to check for the successful completion of the associated communication with calls to MPI_WAIT or MPI_TEST. ... Центры . ...

Еще в разделе: (Показать все результаты (>533) - www.parallel.ru/ )

• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Return status | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Semantics of Nonblocking Communications | PARALLEL.RU -

... Farr J.M. - Top 100 Computer and Technical Careers: Your Complete Guidebook to Major Jobs in Many Fields at All Training Levels . ... Название: Top 100 Computer and Technical Careers: Your Complete Guidebook to Major Jobs in Many Fields at All Training Levels . Автор: Farr J.M. Язык: . ... Armed Forces, job opportunities in 25 47-55 . ... Computer control programmers and operators 25 81-84 . Computer programmers 25 84-87 333 . Computer scientists and database administrators 25 87-90 . ...

Еще в разделе: (Показать все результаты (>12101) - lib.mexmat.ru/ )

• Farinacci J.A. - Guide to Observing Deep-Sky Objects: A Complete Global
• McConnell S. - Code Complete :: Электронная библиотека попечительского совета
• Harrington P.S. - Touring the Universe through Binoculars: A Complete

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>4214) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Over virtually the complete

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>2863) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/s-u/stopme2.txt
• Crydee.sai.msu.(ru,su) Archive

Received at NIC 14-DEC-73 RFC589 NIC #20268 Robert T. Braden UCLA/CCN November 26, 1973 CCN NETRJS SERVER MESSAGES TO REMOTE USER A. I_I_I_L C_N_E_T_O_ S_G_O_ A_D S_G_O_F _N_T_A_ _O_N_C_I_N, _I_N_N, _N_ _I_N_F_ 1. ... If the header is correct but a data record is faulty, the following message will be sent to a remote user: NRJ602I line STREAM ERROR - READER, -codeA protocol error was detected CCN will close the stream and pened so the remote user may operation. ... User may try again. ...

Еще в разделе: (Показать все результаты (>18285) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1-r2.ebuild
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc263.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc263.txt.pdf

The Department of Talented Youth Affairs and Professional Orientation . ... News . ... Older posts . Newer posts . ... 19-20 November 2015, Moscow, the building of the Presidium of the Russian Academy of Sciences. The staff of the Department of Geology and Geochemistry of Fossil Fuels of the Faculty of Geology of Lomonosov Moscow State University took an active Continue reading . Posted in News , Без рубрики | ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>45) - talant.msu.ru/ )

• editor | The Department of Talented Youth Affairs and Professional Orientation
• admin | The Department of Talented Youth Affairs and Professional Orientation |
• The visit of the delegation of Iranian universities | The Department of

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>1974) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>107) - mccmb.belozersky.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>12) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>16) - angel.cs.msu.su/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>1169) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• [RU-NGI] Fwd: [Noc-managers] Availability/Reliability Reports - November 2011
• The RU-NGI Third quarter 2011 Archive by author

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>78) - phys.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>10055) - kodomo.fbb.msu.ru/ )

• allpy: 40c086a41ca0 debian/control.in
• allpy: 1e5116ce9d75 debian/control.in
• allpy: log