XWare Поиск по информационным ресурсам МГУ English Russian
       
       Точная форма слов   О проекте   Сайты   Помощь
Поиск по:www.genebee.msu.ru   - Поискать по всем серверам
На этой странице приведены все страницы сервера www.genebee.msu.ru ,которые мы индексируем. Показаны документы 261 - 280 из 363.

В начало ] Пред. | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | След.

Упорядочить по: URL  |  дате изменения
261. Genebee ClustalW 1.83 Help
ClustalW 1.83 Help Thompson J.D., Higgins D.G., Gibson T.J.; "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice." ... The sequences (cut paste) must all be in ONE of the following formats: . ... The program tries to "guess" which format is being used and whether the sequences are nucleic acid (DNA/RNA) or amino acid (proteins). ... This is the MSF (Multiple Sequence Format) format. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/clustal/help.html -- 20.9 Кб -- 27.02.2004
Похожие документы

262. GeneBee BLAST 2.2.8 Services
Nucleotide BLAST . ... These searches translate either query sequences or databases from nucleotides to proteins so that protein - nucleotide sequences can be performed. ... Takes a protein query sequence and compares it against an NCBI nucleotide database which has been translated in all six reading frames. ... Converts a nucleotide query sequence into protein sequences in all 6 reading frames and then compares this to an NCBI nucleotide database which has been translated in all six reading frames. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/blast_new/blast.html -- 5.1 Кб -- 26.02.2004
Похожие документы

263. GeneBee BLAST 2.2.8 Services Help
... The BLAST programs were tailored for sequence similarity searching for example to identify homologs to a query sequence. ... This program uses a "greedy algorithm" ( Webb Miller et al. ) for nucleotide sequence alignment searches and concatenates many queries to save time spent scanning the database. ... In the programmatic implementations of the BLAST algorithm described here, each HSP consists of a segment from the query sequence and one from a database sequence. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/blast_new/bh_overview.html -- 18.9 Кб -- 26.02.2004
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/megablast/bh_overview.html -- 18.9 Кб -- 26.02.2004
Похожие документы

264. GeneBee BLAST 2.2.8 Services Help
... Peptide Sequence Databases . ... BLAST searches can be limited to the results of an Entrez query against the database chosen. ... For example: Mus musculus[Organism] For help in constructing Entrez queries please see the " Writing Advanced Search Statements " section of the Entrez Help document. ... Only following combinations of the Matrix, Open & Extended Gaps are available: Recomended combinations are colored. ... Gap . ... Standard BLAST alignment in pairs of query sequence and database match. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/blast_new/bh_options.html -- 21.0 Кб -- 26.02.2004
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/megablast/bh_options.html -- 21.0 Кб -- 26.02.2004
Похожие документы

265. GeneBee BLAST 2.2.8 Services Help
... Accepted input types are: A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. ... Sequences are expected to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, U and * are acceptable letters (see below). ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/blast_new/bh_format.html -- 4.9 Кб -- 26.02.2004
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/megablast/bh_format.html -- 4.9 Кб -- 26.02.2004
Похожие документы

266. Genebee BLAST 2.2.8 Services Help
... Why does my search timeout on the BLAST servers? Why do I get the error message "ERROR: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params , check query sequence"? ... What is the Expect (E) value ? ... Certain combinations of BLAST searches with large sequences against large databases can cause the BLAST servers to timeout. ... You can use the BLAST 2.2.8 Sequences service to compare two nucleotide or two protein sequences against each other using the BLAST 2.2.8 algorithm. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/blast_new/bh_faq.html -- 22.1 Кб -- 26.02.2004
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/megablast/bh_faq.html -- 22.1 Кб -- 26.02.2004
Похожие документы

267. Internet Services
... Belozersky Institute . ... Fasta3 at EBI, United Kingdom . ... EFETCH : quick database entry retrievial (by entry name or accession number) at Institute Pasteur ( advanced form ) . Alignment: . ClustalW Multiple Sequence Alignment at EBI . ClustalW ( advanced form ) at Institute Pasteur . ... Global multiple alignment (Bio-lirmm, France) . ... Service at EMBL (Germany) . Service at EBI (United Kingdom) . Service at Institute Pasteur (France) . Service at ExPASy (Switzerland) . ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services.html -- 9.3 Кб -- 05.02.2004
Похожие документы

268. The Russian EMBnet Node
... A.N. Belozersky Institute . GeneBee . Russian EMBnet Node . ... The EMBnet Node . ... Databases . ... Biocomputing Services . ... Organized by Belozersky Institute of Physico-Chemical Biology , Moscow State University . ... As EMBnet node it became operational in 1996. ... providing access to molecular biology software (GCG, WhatIf, home-made software); . ... GeneBee provides molecular biology databases and software facilities for over 90 departments and laboratories within Russian Federation. ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/emb.html -- 6.6 Кб -- 05.02.2004
Похожие документы

269. Laboratory of Nucleic Acids Chemistry
Moscow State University/Nucleic Acids Chemistry /Belozersky Institute . Author: Dmitry A. Aleksandrov . alex-1-a-rus@yandex.ru
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/anb/ORETSKAYA.DEP/ -- 2.0 Кб -- 16.12.2003
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/anb/ORETSKAYA.DEP/index.html -- 2.0 Кб -- 16.12.2003
Похожие документы

270. GeneBee Motifs' Map - Advanced
... GeneBee . ... Advanced GeneBee Motifs' Collection Map . ... General options . Number of motifs to plot . Map title . Number of motifs to output . DotHelix options . ... Dothelix Power threshold . ... DotHelix . ... DNA/RNA Dayhoff Johnson Blosum 30 Blosum 50 Blosum 62 Pam 60 Pam 120 Pam 250 Gonnet 120 Gonnet 250 Gonnet 350 . Other options . ... Motif frequences . ... Comments and bug-reports send to: nik@genebee.msu.su ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/dhm/advanced.html -- 11.0 Кб -- 28.04.2003
Похожие документы

271. GeneBee Motifs' Map
. Homepage . Belozersky Institute . GeneBee . Russian EMBnet Node . Basic GeneBee Motifs' Collection Map . Help . Advanced query . Map title . Enter or Paste here your sequences in Fasta format . Example: . NRAS_2 MTEYKLVVVG AGGVGKSALT EYDPTIEDSY RKQVVIDGET CLLDILDTAG QEEYSAMRDQ YMRTGEGFLC VFAINNSKSF ADINLYREQI KRVKDSDDVP MVLVGNKCDL HELAKSYGIP FIETSAKTRQ GVEDAFYTLV REIRQYRMKK LNSSDDGTQG CMGLPCVVM . Comments and bug-reports send to: nik@genebee.msu.su . Last updated: January 14, 2001.
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/dhm/basic.html -- 6.2 Кб -- 28.04.2003
Похожие документы

272. I
. M.V. Lomonosov Moscow State University . A.N. Belozersky Institute . of Physico-Chemical Biology . ANNUAL REPORT . 2002 . CONTENT . Biology of cell and cell organelles . Bioenergetics and photosynthesis . Mathematical models in biology . Molecular virology . Structure, expression and evolution of genom . Enzymology and biotechnology . Modifications of vestibular responses of individual reticulospinal neurons in lamprey caused by unilateral labyrinthectomy . Deliagina T.G., Pavlova E.L. Journal of
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/ann2002.html -- 443.9 Кб -- 28.02.2003
Похожие документы

273. http://www.genebee.msu.ru/embl.release
... CON entries in file 'embl.con' do not contain sequence data per se. ... File Number File Name Description Number of Records 1 CRC.TXT Checksum CRC uncompressed files 278 2 CRC_GZ.TXT Checksum CRC compressed files 278 3 DELETEAC.TXT Deleted accession numbers 187325 4 EMBL .CON Constructed Sequences 13437 5 FTABLE.TXT Feature Table Documentation 474 6 RELNOTES.TXT Release Notes (this document) 1327 7 SUBINFO.TXT Data Submission Documentation 390 8 UPDATE.TXT ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/embl.release -- 62.0 Кб -- 17.01.2003
Похожие документы

274. RNA secondary structure prediction
... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/rna2_full.html -- 6.8 Кб -- 11.11.2002
Похожие документы

275. Fasta3 help
... W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444- 2448, . W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA" Methods in Enzymology 183:63- 98). ... YOUR SEQUENCES . ... Free text sequencens which are simply a block of characters representing a DNA or Protein sequence are also accepted. ... scan a protein or DNA sequence library for similar sequences . ... compare a DNA sequence to a protein sequence database, . ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/fasta/help.html -- 13.0 Кб -- 17.07.2002
Похожие документы

276. Notes on searching by similarity
... Normally protein sequence (alignment) goes against protein databanks (SWISSPROT and PDB), but since the comletion of the protein databanks falls far behind the adds to the databank of nucleotide sequences (EMBL), there is the possibility of screening the protein sequence along desirable parts of EMBL (with translation of the direct and complementary chains in six reading frames). ... We shall call the probability, measured in a such way, the POWER of the motif/alignment. ... unannotated sequences, ....
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/hlp/req1hlp.html -- 34.9 Кб -- 08.07.2002
Похожие документы

277. I
. M.V. Lomonosov Moscow State University . A.N. Belozersky Institute . of Physico-Chemical Biology . ANNUAL REPORT . 2001 . CONTENT . Biology of cell and cell organelles . Bioenergetics and photosynthesis . Molecular virology . Structure, expression and evolution of genom . Enzymology and biotechnology . Biology of cell and cell organelles . Proteinase inhibitors in Nauphoeta cinerea midgut . Elpidina E.N., Vinokurov K.S., Rudenskaya Yu.A., Dunaevsky Ya.E., Zhuzhikov D.P. Archives of Insect Biochemistry and
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/ann2001.html -- 329.1 Кб -- 30.05.2002
Похожие документы

278. Multiple alignment
... GeneBee . ... AliBee - Multiple Alignment . ... Result Alignment Format: . GeneBee Fasta (Pearson) Fasta (DNA) Clustal (ALN) Phylip PIR Text . ... Comments on output . Tree and Picture Options . Extra tree format . None Phylip Phylip (multiline) Nexus Nexus (TREES block only) Hennig86 . Picture formats . None Slanted Slanted 2 Rectangular Rectangular 2 Phylogram Unrooted Unrooted 2 . ... You can paste or edit your sequences right here (in FASTA format) . ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/malign_reduced.html -- 7.3 Кб -- 15.12.2001
Похожие документы

279. Multiple alignment
... GeneBee . ... AliBee - Multiple Alignment . ... Comments on output . ... Minimum letter frequence . ... Minimum homology ratio (0 to 1) . ... DNA/RNA Blosum 30 Blosum 50 Blosum 62 Dayhoff Johnson . ... Default DNA\RNA Protein . ... Result Alignment Format: . GeneBee Fasta (Pearson) Fasta (DNA) Clustal (ALN) Phylip PIR Text . ... Extra tree format . None Phylip Phylip (multiline) Nexus Nexus (TREES block only) Hennig86 . ... You can paste or edit your sequences right here (in FASTA format) . ...
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/malign_full.html -- 10.1 Кб -- 15.12.2001
Похожие документы

280. HELP
... Nikolaev V.K., Leontovich A.M., Drachev V.A., Brodsky L.I. Building multiple alignment using iterative analyzing biopolymers structure dynamic improvement of the initial motif alignment, 1997, Biochemistry, 62,6,578-582. ... Multiple Sequence Alignment is the arrangement of several protein or nucleic acid sequences with postulated gaps so that similar residues (in one-letter code) are juxtaposed. ... construction of pairwise MOTIFS . ... POWER . ... to create all pair motifs ("Sequence-sequence"); ....
[ Сохраненная копия ]  Ссылки http://www.genebee.msu.ru/services/Ma-help.html -- 40.2 Кб -- 07.12.2001
Похожие документы

В начало ] Пред. | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | След.

Rambler's Top100 RFBR Яндекс цитирования