... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... World Data Systems functions under the sponsorship of the International Council for Science ICSU since 1956 (until 2008 in the form of two structures - World Data Centers and the Federation of Astronomical and Geophysical Data Analysis Services). ... Map "The population of the Russian Federation", scale 1:7 500 000, Russian Geographical Society, Faculty of Geography Moscow State University, OOO "FOC", 2014. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Undergraduate study
• Satino teaching and research station
• Department of Cartography and Geoinformatics

... 31-Oct-2005 10:50 . 283 . ... 2.0K . ... 241 . ... Apache/2.2.16 (Debian) Server at www.kosmofizika.ru Port 80 ...

Еще в разделе: (Показать все результаты (>234) - www.kosmofizika.ru/ )

• Magnetometers Database
• Index of /spravka

... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...

Еще в разделе: (Показать все результаты (>2) - www.iisi.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>9) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... education . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . ... admission in January 2010 . ... MSU Faculty of Chemistry announces a new Master?s Program in Composite Nanomaterials, 510500 Chemistry. The program is under the aegis of MSU Nanotechnology Education and Research Center. ... The program is aimed mainly at graduates and young scientists, including Candidates of Science, in chemistry or physics (additional higher education.) ...

Еще в разделе: (Показать все результаты (>15) - nano.msu.ru/ )

• Composite Nanomaterials Master?s Program | MSU Nanotechnology Education and

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

... Sunday, November 4, 2007 |4:30 - 6:30pm |Flight SU #303 arrives to |Pickup at Pearson Int'l Airport | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | Monday, November 5, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ... Tuesday, November 6, 2007 |7:00 - 8:00am |Breakfast |Executive Dining Room | ... 12:30 - 1:30pm | ... Wednesday, November 7, 2007|7:00 - 9:00am |Breakfast |Executive Dining Room | ... Thursday, November 8, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Oct28-Nov5_2007.doc

... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...

Еще в разделе: (Показать все результаты (>6) - ndsipu.cmc.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• StructAlign help
• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

... Главная . ... Контакты . ... Ленинские горы, дом 1, строение 12 . Москва, почтовый индекс 119991 . ... Телефон: +7(495) 987 65 21 . Факс: +7(495) 987 65 21 . ... Ленинские горы, дом 1, . ... 7 (495) 939-10-00 . ...

Еще в разделе: (Показать все результаты (>4) - depository.msu.ru/ )

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...

196. Студенческий сайт Физфака МГУ