.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>11) - uranus.sai.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... 26, No. 9, 791ґ799 doi:10.1006/cbir.2002.0946, available online at http://www.idealibrary.com on CENTROSOME -DEPENDENT ANISOTROPIC RANDOM WALK OF CYTOPLASMIC VESICLES IVAN V. MALY* and IVAN A. VOROBJEV Laboratory of Cell Motility, A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow 119899, Russia Received 27 September 2001; accepted 28 June 2002 We approach the problem of an apparently random movement of small cytoplasmic ... 1997; Bray, 2001). ... 1997). ...

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/grigoriev99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva95.pdf

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>63) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

Еще в разделе: (Показать все результаты (>2) - www.fnm.msu.ru/ )

Educational program of the project is intended for training of specialists in different fields of space physics, astronomy and the Earth sciences. ... Special space-physics lab exercises are intended for the students of the senior courses of the Institutions, specialized in the field of space engineering and space physics. Its main task is to teach them some methods of satellites scientific and engineering data processing. ...

Еще в разделе: (Показать все результаты (>69) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

• The NMW survey homepage

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... Время и взаимодействие . ... Гравитация как следствие расширения среды весомых тел [размещено на сайте 15.05.2009] . ... С.176-206 (PDF-файл, 1.2 Мб) [обновлено на сайте 15.04.2009] . ... PDF-файл, 7577 Кб) [размещено на сайте 03.11.2013] . ... Время и квантовое поведение (PDF-файл, 630 Кб) [размещено на сайте 09.06.2006] . ... Interacting Two-Time Physics Field Theory With a BRST Gauge Invariant Action (PDF file, 300 Kb) [distributed 01.07.2007] . ... PDF-file, 233 Kb), [Distributed 08.11.2010]. ...

Еще в разделе: (Показать все результаты (>17) - temporology.bio.msu.ru/ )

• Russian Roulette / Русская Рулетка
• Institute Laboratory-Chairs
• Уравнения динамики систем

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>70) - ffl.msu.ru/ )

... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...

Еще в разделе: (Показать все результаты (>25) - www.lssm.inorg.chem.msu.ru/ )

Tomkovich & Soloviev: Schedule and geographic distribution on the breeding grounds 19 Curlew Sandpipers Calidris ferruginea on their breeding grounds: schedule and geographic distribution in the light of their breeding system P.S. TOMKOVICH1 & M.Y. SOLOVIEV2 1 Zoological Museum, Moscow Lomonosov State Univ., ... 1994, Schekkerman & van Roomen 1995), or the large fluctuations in species numbers on some breeding grounds (e.g. Tomkovich et al. ... Notes on the breeding habits of the Curlew Sandpiper. ...

Еще в разделе: (Показать все результаты (>65) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Shedlock_Okada_2000_BE.pdf
• http://vertebrata.bio.msu.ru/pub07_waterbirds_part3.3.1.2.pdf
• http://vertebrata.bio.msu.ru/Alticola_zsc_.pdf

... TEX METAFONT , TEX - . ... TEX; Internet ftp://sunsite.unc.edu/pub/academic/russianstudies/Software/PSfonts/pscyr.tar.gz. ... AcademyPSCyr), Regular , Bold , Italic Ї (HandbookPSCyr), Regular , Bold , Italic Ї (CollegePSCyr), Regular , Bold , Italic Ї (AntiquaPSCyr), Regular , Bold , Italic Ї (Lazurski), Regular Ї (TimesNewRomanPSMT), Regular , Bold , Italic , Bold Italic : Ї (ArialMT), Regular , Bold , Italic , Bold Italic , Black Ї (TextbookPSCyr), Regular , Bold ,...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:
• Database: publications on x-ray absorption spectroscopy

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - hpc.cs.msu.ru/ )

... Synchronous Evolution of Galaxies in Groups: NGC 524 Group O. K. Sil'chenko and V. L. Afanasiev 245 ISSN 1990-3413, Astrophysical Bulletin, 2012, Vol. ... Four of the five galaxies revealed synchronized bursts of star formation in the nuclei 1ґ2 Gyr ago. The only galaxy, in which the ages of stellar population in the nucleus and in the bulge coincide (i.e. the nuclear burst of star formation did not take place) is NGC 502, the farthest from the center of the group of all the galaxies studied. ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ic3653.pdf
• http://sn.sai.msu.ru/~sil/preprints/al227.pdf
• http://sn.sai.msu.ru/~sil/preprints/leo3.pdf

... MBA . EXECUTIVE MBA . ... Международные связи . ... Международная конференция в Риге 'Define Europe - Different Sculptors, One shape' . ... В конференции примут участие представители различных международных организаций: . ... Янис Биркс (Janis Birks) - Мэр г. Рига и др. ... Конференция будет проходить в Риге, Латвия с 8 по 11 Октября 2009 года. ... Executive MBA . ... Членство в международных образовательных ассоциациях и альянсах . ...

Еще в разделе: (Показать все результаты (>94) - www.mgubs.ru/ )

• The Ljubljana Summer school

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>91) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity
• Coordinate Systems
• Магнитосферно-ионосферное взаимодействие ( M-I coupling)