... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...
[
Текст
]
Ссылки http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc -- 215.0 Кб -- 19.03.2014 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Individual SELEX products, aptamers, are small molecules (40100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf -- 375.6 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/molbio2000.pdf -- 375.6 Кб -- 18.02.2008 Похожие документы
1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...
МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... Departments . ... Department of Environmental Management . ... Mazurov Yu.L. (Environmental management, heritage, sustainable development), Doctor of Geography . ... Environmental management , Natural and cultural heritage, Natural protected areas, History of environmental management , Geoecological monitoring, Geographical environment s development and transformation, System ecology, Contaminants and their properties, Laboratory and fields research methods, Methods of processing ...
The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf -- 1614.3 Кб -- 25.10.2012 Похожие документы
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...
... Профессоры кафедры . ... Кафедра математического анализа создана в 1933 году вместе с созданием механико-математического факультета. ... Кафедра обеспечивает преподавание базового двухгодичного курса математического анализа студентам первого и второго курса механико-математического факультета, курса анализа студентам химического факультета, курса высшей математики студентам географического факультета, биологического факультета, факультета почвоведения, факультета фундаментальной медицины. ...
The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...
О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...
... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...
... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....
... N 3 Contents Anthropology Goodkova L.K. The value of works of Y.Y. Roginsky for the development of physiological anthropology (p. 4-9) The works of Y.Y. Roginsky on variability, correlation and integrity were of great importance for the development of physiological, ecological, anthropology. ... Race of the child is also mentioned as a possible factor. Y. Roginsky was particularly interested in age changes of different anthropometric and anthroposcopic traits in children of different ethnicities. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2015_3.doc -- 54.0 Кб -- 14.01.2016
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2015_3.doc -- 54.0 Кб -- 14.01.2016 Похожие документы
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы