sparallel.ru . Мокасины кеддо . Где летние сапоги купить . ... Мягкая стелька обеспечивает комфорт при ходьбе. ... Комфортная обувь для города ? ... Детские ортопедические открытые сандалии TW-110 (белые) обеспечивают комфорт, равновесие и максимальную устойчивость при ходьбе и снижают нагрузку на суставы Посмотреть весь каталог: Детская ортопедическая обувь Особенности: сандалии. Коллекция обуви ?JOOK by Ralf Ringer? появилась в тюменских магазинах сети ?Детский мир?. ... Ricima обувь . ...

Еще в разделе: (Показать все результаты (>355) - sparallel.ru/ )

• Centro оренбург каталог обуви | sparallel.ru
• Carry обувь | sparallel.ru
• Alida резиновые сапоги | sparallel.ru

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

... BBA ? Lipids and Lipid Metabolism [ BBA Lipid Lip Metabol] . Common information . ... no information] . ... since 1965-02-01 till 1998-11-02 . ... biology ->biochemistry ->lipids membranes . ... Recently was "BBA - Specialized Section on Lipids and Related Subjects". Now is "BBA - Molecular and Cell Biology of Lipids". ... Elsevier Science . ... http://elibrary.ru/title_about.asp?id=99 . ... http://www.sciencedirect.com/science/.. ... http://www.sciencedirect.com/science/... 1971 . ...

Еще в разделе: (Показать все результаты (>82) - journals.genebee.msu.ru/ )

Federation of European Societies on Trace Elements and Minerals PRELIMINARY SCIENTIFIC PROGRAM 09.06.2010 SESSION 1. Trace element and mineral analysis of environmental and biological samples: bulk determination, speciation and quality control. ... 10.06.2010 SESSION 2. ... SYMPOSIUM ORGANIZATION Venue The 4th International Symposium on Trace Elements and Minerals in Medicine and * Biology will take place in the Hotel "Okhtinskaya" (4, Bolsheokhtinsky prospect, 195027 St.Petersburg, Russia). ...

Еще в разделе: (Показать все результаты (>7) - www.fbm.msu.ru/ )

Laboratory of Rare Earth Intermetallics . Chair of General Physics and Magneto-Ordered Matter . ... The primary research work is related to the study of magnetic phase transitions in rare earth (RE/R) intermetallic compounds with transition elements of the iron group, i.e. R-3d intermetallics. ... These works stimulated studies of different aspects of a magnetic instability of the itinerant-electron subsystem in RMn 2 , RCo 2 , and RCo 3 compounds in many research institutions and universities. ...

Еще в разделе: (Показать все результаты (>22) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Physics Department of Moscow State University

. LABORATORY . FOR . COMPUTATIONAL . LEXICOGRAPHY . Русский . Home . History . Research . Publications . Linguistic expeditions . Seminar . People . Contact . Linguistic expeditions 20 10 . Photogallery : Linguistic expeditions 20 10 . Photogallery: Novoyugino, June-July 20 1 0 . Novoyugino . The Angalin sisters , our Khanty informants, . Antonina Yurievna , Tamara Yurievna and . Svetlana Yurievna . Yuriy Petrovich Angalin with his daughters and his relative Taisia Pavlovna Myldzhina .

Еще в разделе: (Показать все результаты (>13) - lcl.srcc.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>60) - www.chemport.ru/ )

• "R scientist/expert in catalysis-related chemistry, phd" - вакансия в разделе
• "R scientist/expert in catalysis-related chemistry, phd (m/f)" - вакансия в

... If not, see http://www. gnu .org/licenses/ . # = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = # query sequence file: /data/npidb/pdb/pdb_new/fasta/pdb6gat.pdb.fas # searching against: /mnt/databanks/pfamdata/Pfam-A. hmm , with cut off -E 0.001 --domE 0.001 # resolve clan overlaps: on # predict active sites: off # = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = # # seq id alignment ...

Еще в разделе: (Показать все результаты (>6942) - mouse.belozersky.msu.ru/ )

• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/10mh.pdb1.pdb.hmm.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/185d.MDL1.pdb.hmm.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/193d.MDL1.pdb.hmm.txt

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>7) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/d0note_3612.ps

TITLE OF THE ABSTRACT FIRST I. AUTHOR1, SECOND I.J. AUTHOR2 AND THIRD AUTHOR2 1Organization name of the first author first_ author@email.ru 2Organization name of the second and third authors second.author@email.com, third_author@mail.eu Key words: list up to eight words or group of words in order of priority, separated by commas. ... The abstract including figures, tables and reference should not exceed 1 page. The title should be centered in the page, in 11pt, boldface Roman, all capital letters. ...

Еще в разделе: (Показать все результаты (>15) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf
• http://hit-conf.imec.msu.ru/2006/CD/PetrovaLI.doc

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qnazmutdinov.pdf
• http://www.elch.chem.msu.ru/mole/lecture/qsavinova.pdf
• http://www.elch.chem.msu.ru/mole/lecture/feldman.pdf

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...

Еще в разделе: (Показать все результаты (>23) - www.sai.msu.ru/ )

• Uploading Files

... To efficiently cover 1 km detection volume it would be necessary to deploy % 104 photomultipliers whose main requirements are a relatively large photocathode area, high gain, low noise, low after pulse rate and good timing resolution for single photon detection, the exact values depending on the detector design. ... Instr. and Meth. ... We identified four different types of secondary pulse according to the following definitions: Pre-pulse: pulses arriving at 10-80 ns before the main pulse, Fig. ...

Еще в разделе: (Показать все результаты (>14) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf
• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>7) - swx.sinp.msu.ru/ )

. Название публикации . Kinase related protein/telokin inhibits microcystin-induced Ca2+-independent contraction in triton skinned guinea pig taenia coli . Авторы . O. Shcherbakova, D. Serebryanaya, A. Postnikov, S. Zittrich, V. Shirinsky, A. Vorotnikov, G. Pfitzer . Дата . 31.12.2009 23:00:00 . Название журнала . Biochem. J. Том . Vol.429. Номер . 2 . первая страница . 291 . последняя страница . 302. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>6) - fbm.msu.ru/ )

Another mechanical model of parametrically excited pendulum and stabilization of its inverted equilibrium position Anton O. Belyakov 1 Lomonosov Moscow State University 2 Vienna University of Technology 8th European Nonlinear Dynamics Conference (ENOC 2014) Vienna, July 7, 2014 Scheme of a parametric pendulum y O l (t ) - g m 2 r1 + m 2 Equations of motion mr 2 1 d d2 + c1 + m g l (t ) sin () = 0 dt 2 dt (1) Dimensionless equation Three dimensionless parameters and ...

Еще в разделе: (Показать все результаты (>8) - belyakov.imec.msu.ru/ )

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

218. http://geophys.srcc.msu.ru/library/parcfd2003.pdf

219. APOD: January 29, 1998 - The Earth-Moon System

220. http://magn115.phys.msu.ru/scprogr/lecture12.pdf