... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

... April, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... The International scientific conference of students, post-graduate students and young scientists "Lomonosov" was opened at the Moscow State University in the Assembly hall of the Main building. (more.. ... MGU Russian Language Centre changed the prices for special offers and distance training web-page is coming soon. ...

Еще в разделе: (Показать все результаты (>5) - www.rlcentre.com/ )

КАФЕДРА КВАНТОВОЙ СТАТИСТИКИ И ТЕОРИИ ПОЛЯ . ... Основные научные направления научной и педагогической работы . Математические методы современной термодинамики. Под руководством академика В.П. Маслова развивается современная т еория, основанная на экспериментальных данных о состояниях вещества: его критическ ой и тройной точках, а также двух точках Бойля. ... Литература : . ... Руководитель направления : а кадемик РАН, профессор В.П.Маслов . Комната 4 -67, тел . 939-12 -90 . ...

Еще в разделе: (Показать все результаты (>2) - qsft.phys.msu.ru/ )

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>18) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• BUFFERING CAPACITY OF FOREST LITTERS
• THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY

Open Conference Systems . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Author . ... Current Conferences . ... Conf. on Lasers, Applications, and Technologies > About the Conference > Conference Policies . ... Archive Access Policy . ... The presentations that make up the current and archived conferences on this site have been made open access and are freely available for viewing, for the benefit of authors and interested readers. ...

Еще в разделе: (Показать все результаты (>19) - hea.phys.msu.su/ )

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Фев 13 . ... Posted in Мокасины . ... Posted in Туфли . ... Posted in Кросовки . ... Posted in Сапоги . ... Разное . ...

Еще в разделе: (Показать все результаты (>2) - sparallel.ru/ )

• sparallel.ru - Part 252

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...

Еще в разделе: (Показать все результаты (>42) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/Mendeleev-2012.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>95) - swx.sinp.msu.ru/ )

• SWX - Данные
• SWX - Данные Satellite trajectories

... About hotel . ... Rooms and prices . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... The hotel ?69th Parallel? offers comfortable single and twin rooms and deluxe rooms relevant to the European standards. Every room has free WiFi connection. ... SINGLE STANDARD ROOM . Single occupancy ? 1 800 rub./day . ... 200 rub./person . ... 2 200 rub./day . ... The prices are in rubles for room a day and include the VAT (18%) . ...

Еще в разделе: (Показать все результаты (>7) - 69parallel.ru/ )

. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:Contributions/93.180.27.85 " . Special page . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . Special pages . Privacy policy . About MediaWiki . Disclaimers

Еще в разделе: (Показать все результаты (>63) - algcourse.cs.msu.su/ )

• Log in / create account - MediaWiki

The Department of Talented Youth Affairs and Professional Orientation . ... UAE Ambassador in MSU . ... On May 24, 2014 (Saturday) at 12:00 the MSU Botanic Garden will host the opening of ?Emerald City?, which is a specialized tour area for children with special needs. The project ?Emerald City? has already been designed in 2009. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>48) - talant.msu.ru/ )

• International Student Olympiad in Iran | The Department of Talented Youth
• News | The Department of Talented Youth Affairs and Professional Orientation |

... Вы находитесь на сайте кафедры теоретической физики физического факультета МГУ им. М.В. Ломоносова. Здесь Вы можете получить разнообразную информацию о сотрудниках, читаемых курсах лекций, познакомиться с историей кафедры. О кафедре . ... Кафедра теоретической физики физического факультета МГУ им. М.В. Ломоносова, 2006 ...

Еще в разделе: (Показать все результаты (>12) - theorphys.phys.msu.ru/ )

• Kirill A. Kazakov

A program for automatic detection of aligned blocks in multiple protein alignment. Paste your alignment in fasta-format here: . ... The program works slow - it takes 8 seconds to process alignment of 6 sequences of length 500. The program's development is supported by Russian Foundation for Basic Research (grant 10-07-00685-a) and Ministry of Education and Science of the Russian Federation (State Contract No. 07.514.11.4006). ...

Еще в разделе: (Показать все результаты (>6) - mouse.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis

... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker­Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...

Еще в разделе: (Показать все результаты (>17) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JMathSci-InN.pdf

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>53) - dfgm.math.msu.su/ )

• Conference dedicated to the memory of Professor Yu. P. Solovjev

Вы посетили: activ_engl.html . ... История кафедры . ... Editor of the special issue of the journal Linear Algebra and its Applications devoted to Idempotent and Tropical Mathematics, 2010 . Editor of the journal Fundamental and Applied Mathematics . ... Linear Algebra and its Applications . Linear and Multilinear Algebra . ... Electronic Journal of Linear Algebra . ... staff/guterman/activ_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>24) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• Index of /courses/phys_tsu/lecture04/

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...