... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... 1, 119899 Moscow, Russian Federation shamolin@imec.msu.ru ABSTRACT This work is devoted to the development of qualitative methods in the theory of nonconservative systems that arise, e.g., in such fields of science as the dynamics of a rigid body interacting with a resisting medium, oscillation theory, etc. ... References [1] M.V. Shamolin, Methods of Analysis of Dynamical Systems with Variable Dissipation in Dynamics of a Rigid Body [in Russian]. ...
... The Department of Operations Research . ... Coordinators Contacts . ... on Operations Research, . ... Moscow, April 10-14, 2007 Coordinators . ... 1) New models and methods . Prof. V.V. Morozov . ... 3) Multiple objective decision making . ... Prof. I.G. Pospelov, Prof. A.A. Shananin . ... Prof. A.A. Belolipetckiy . ... 9) Game-theoretic models . ... Symposium A: Analysis of the markets and decision making in electric power industry . ... Symposium B: Models of political decision making. ...
... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология >> Геохимические науки >> Минералогия | Анонсы конференций . ... И.С. Фомин / Геологический факультет МГУ . ... Российская академия наук Институт геологии Коми научного центра УрО РАН Российское минералогическое общество Международный минералогический семинар МИНЕРАЛОГИЧЕСКИЕ ПЕРСПЕКТИВЫ Уважаемые коллеги! Институт геологии Коми научного центра Российской академии наук . ... Геология . ... Минералогия . ...
Leo Bokeria. ... Winner of numerous state awards and the international Golden Hypocrite Prize, chief cardiac surgeon of the Ministry of Health, Leo Bokeria is considered to be one of the best world's cardiac surgeons, a famous scholar and organizer of medical science. ... Leo Bokeria enjoys the highest prestige and has earned respect as a serious scholar and an excellent surgeon who has given life to thousands of patients, giving each of them part of his own heart. ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/last_year_theses_by_A_Rakitko.pdf -- 85.1 Кб -- 10.03.2012 Похожие документы
Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf -- 1942.1 Кб -- 18.10.2010 Похожие документы
News of PARALLEL.RU par-news на mail.parallel.ru . Пт Июл 8 16:22:15 MSD 2011 . ... Выпуск 311 . 8 июля 2011 г. ------------- Опубликована вторая редакция списка Graph500, в которой суперкомпьютер Ломоносов оказался на 3-ем месте. http :// parallel.ru / news /graph500_2edition.html ------------- С 26 июня по 2 июля 2011 г. в Московском государственном университете имени М.В.Ломоносова при поддержке Суперкомпьютерного консорциума университетов России ...
... Проводится запись на очные курсы СУНЦ МГУ на 2011-12 учебный год . ... ФМШ.ру - обучение одаренных детей . ... СУНЦ МГУ школа им. А.Н.Колмогорова . ...
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... University of Groningen, The Netherlands . PhD Position available . ... PhD Position in Theoretical Chemistry . ... She is considered to be one of top 5 universities in Europe for research in Materials Science, Chemistry, Space Science, Microbiology, and Environment/Ecology. ... In 1993, the MSCplus was accredited by the Royal Netherlands Academy of Arts and Sciences (KNAW) as a leading Research School in Materials Science. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Main practical applications of X-rays lie in the important for the society fields of medical imaging, custom, transport inspection and security. Scientific applications besides of fundamental research include material sciences, biomicroscopy, and protein crystallography. ... The first are relatively cheap, robust, and compact but have low brightness and poorly controlled photon spectrum. ... So accelerator based X- ray sources are mainly still used for scientific applications and X-ray tubes ? ...
International Conference Fluxes and Structures in Fluids : Physics of Geospheres FLUXES AND STRUCTURES IN FLUIDS : PHYSICS OF GEOSPHERES International Conference PROGRAMME FLUXES AND STRUCTURES IN FLUIDS CO-SPONSORS RUSSIAN ACADEMY OF SCIENCES RUSSIAN FOUNDATION FOR BASIC RESEARCH NATIONAL SCIENCE FOUNDATION (USA) THE CONFERENCE IS ORGANISED BY ... D.M. Klimov (Russia), Prof. S. Kimura (Japan), Acad. ... Coffee Break 2-nd Morning Session 11:30 13:00 Section 1 11:30 11:45 .. ...
Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Outreach . ... TEPA?2012 was held at Lomonosov Moscow State University, Russia. ... Workshop on ?Lomonosov? project held in Moscow State University, November, 28-30, 2011 . ... Current state of the project as a whole. ... Space vehicle status. ... Universitetsly-Tatiana-2?, and the space project ?Chibis?, being developed by Space Research Institute of RAS (IKI RAS) in collaboration with Moscow State University. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012 Похожие документы
You are here: Foswiki > Main Web > EResoursesMSU (revision 3) Edit Attach . Прежде всего, основная ссылка: Список электронных библиотек, к которым имеет доступ МГУ . Информация на март 2012 года: Добрый день коллеги! Два дня назад для нашего университета был открыт доступ к новой архивной коллекции, а именно научным журналам издательства Oxford University Press. ... 1 British Journal of Aesthetics . ... 7 The British Journal For The Philosophy Of Science . ... Materials Science . ...
О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...