... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... University of Groningen, The Netherlands . PhD Position available . ... PhD Position in Theoretical Chemistry . ... She is considered to be one of top 5 universities in Europe for research in Materials Science, Chemistry, Space Science, Microbiology, and Environment/Ecology. ... In 1993, the MSCplus was accredited by the Royal Netherlands Academy of Arts and Sciences (KNAW) as a leading Research School in Materials Science. ...

Еще в разделе: (Показать все результаты (>17) - www.physcareer.ru/ )

arxiv:1008.3999 Наблюдения космических электронов на Fermi LAT на энергиях от 7 ГэВ до 1 ТэВ (Fermi LAT observations of cosmic-ray electrons from 7 GeV to 1 TeV) . Authors: Fermi LAT collaboration . ... Authors: Andrey E. Vladimirov et al. обзор arxiv:1008.5032 Релятивистская прецессия спина в двойных пульсарах (Relativistic spin-precession in binary pulsars) . Authors: Michael Kramer . ... обзор arxiv:1008.2144 Массивные звезды и их сверхновые (Massive Stars and their Supernovae) . ...

Еще в разделе: (Показать все результаты (>113) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/bethe.pdf
• Astronomy links

. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .

Еще в разделе: (Показать все результаты (>2) - gpu.parallel.ru/ )

• Терминология

. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>4) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Milko_Kreier_2007_en.pdf

Supercomputer consortium of Russia's universities creation A G R E E M E N T Under this Agreement - Moscow State Lomonosov University, - Nizhny-Novgorod State Lobachevsky University, - Tomsk State University, - South-Urals State University, referred hereinafter as "the Parties", have defined their arrangements on creation of Supercomputer consortium of Russia's universities 1. ... The full official name of the entity in Russian language is: Supercomputer consortium of Russia's universities. ...

Еще в разделе: (Показать все результаты (>17) - www.rsr-online.ru/ )

THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...

Еще в разделе: (Показать все результаты (>12) - www.protein.bio.msu.ru/ )

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>4) - qsar.chem.msu.ru/ )

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>2) - lvk.cs.msu.su/ )

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>4) - geophys.srcc.msu.ru/ )

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>2) - asa.guru.ru/ )

.., . . , . (e-mail: kano_igt@mail.ru) , , , , , youth, theories of youth, Generation, youth subculture, youth transit , . , , - . . In the article the basic conceptions of youth presented in the western sociology are considered. Four groups of conceptions which presents both in scientific, and in political discourse are allocated. The special attention is given to consideration of youth in the context of contemporary transit theories.

Еще в разделе: (Показать все результаты (>5) - vestnik.socio.msu.ru/ )

... Астрономические данные в Сети - где искать и как пользоваться? Сайты с астрономической библиографией . ... Солнечные сайты . ... Астероидные сайты . ... http://www.uic.rsu.ru/astro/ А наиболее полный список на сайты по теме " что почитать по астрономии " (по-русски) можно найти в соответствующем разделе рейтингового каталога АстроТоп-100 . ... Прекрасная система поиска позволит Вам найти обзорные статьи практически по любому разделу современной науки - от физики и астрономии до химии и биологии. ...

Еще в разделе: (Показать все результаты (>8) - www.astrotop.ru/ )

Cell Biology International. ... Drugs, time of treatment Control active centriole inactive centriole DNP , 30min active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole Short MTs with Long MTs with Short MTs with Long MTs with Total number free ends attached end attached end free ends of ... 50.4 ± 3.1 MTs radiated from the centrosome in cells treated with DNP for 30 min. ...

Еще в разделе: (Показать все результаты (>23) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/grigoriev97.pdf
• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Alieva04.pdf

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

• A Little History

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>4) - hep.phys.msu.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>8) - innovation.msu.ru/ )

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>26) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf
• http://ideas.msu.ru/docs/guide_for_applicants_StG_2012.pdf
• http://ideas.msu.ru/docs/Guide_SyG_2012.pdf

... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...

Еще в разделе: (Показать все результаты (>5) - www.test.physchem.msu.ru/ )