... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>7) - geophys.srcc.msu.ru/ )

... It operates with high efficiency inside a 1 T magnet in an intense charged particle beam of up to 3 в 106 particles/s. It uses a unique light collection system combining air space, wavelength shifter disc and conventional lucite light guides. ... Description of the counter The final CPVA counter is composed of a plastic scintillator, an air light guide, a wavelength shifter disc, lucite wave guides and two phototubes; their configuration and dimensions are given below. ... Optics of the CPVA counter...

Еще в разделе: (Показать все результаты (>45) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/obraztsov_06_04_16.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/zhigareva_23-04-13.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_Cyl-Drift-Ch.pdf

... General ideas of classical game-theoretic analysis: Game in normal form (as a model of players interaction) -Several participants (players) - Several possible strategies for each player -Payoff functions Principle of Nash equilibrium (as a method to define agents strategies during their interaction) -Nash equilibrium is a basic concept of game theory. ... If is not an equilibrium then mutants with pure strategy that is a best reply to have grater payoff than the average payoff for the main...

Еще в разделе: (Показать все результаты (>11) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2013/FINAL/Program_ORM2013_ENG.pdf

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Западная пивная компания приглашает на работу на должность System Network Administrator. ... Опыт работы от двух лет. ... Опыт работы с сетевым оборудованием Cisco. ... Западная пивная компания приглашает на работу на должность SAP Basis/DB2 Administrator. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ... Комментарии и предложения присылайте на адрес info@cmc online.ru . ...

Еще в разделе: (Показать все результаты (>10) - www.cmc-online.ru/ )

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>6) - phys.web.ru/ )

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Asian and African Studies . ... Management . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... Lomonosov Moscow State University Business School invites all talented, innovative and unconventionally thinking students and young scientists to participate in XXIII International Student, Postgraduate and Young Scientists Conference Lomonosov . ... modern management concepts and tools in international business . ...

Еще в разделе: (Показать все результаты (>40) - conf.msu.ru/ )

• New event / МГУ имени М.В.Ломоносова

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>5) - tunka.sinp.msu.ru/ )

... The Sixth International Conference «Scientific Issues in Security and Combating Terrorism », Moscow, 11 - 12th of November, 2010 The Council of Europe approach to the international information security in the context of the fight against terrorism Ms. Marta Requena, Head of the Public International Law and Anti- Terrorism Division Head of the Counter Terrorism Task Force, Council of ... States certainly remain the principle actors of the fight against terrorism. ...

Еще в разделе: (Показать все результаты (>4) - www.iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc

... - behave-, believe-, blurred-, body- border- both-; ... , ... bottom-, bursary- but-, , ; ; , calculate-, capable-, , carry-, ~ away - ~out- Cartesian- case-, cause-; cathode- centre- 4 certainly-, champion- (- ), , , change-, , characterise-() characteristic-, ... weight- whereas- while-, whole-, wide-, , width- witness-, wonder- no ~ - worth- to be ~ doing smth- - Y yield- Z zinc- 35 ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part2.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>5) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

... The plate is blown over by a gaseous flow . ... Область задания функции . Domain of definition of a function . ... Range of a (the) matrix . ... Обратная величина относительно сложения . ... Common axis of symmetry . ... Volume of the displaced liquid (fluid) . ... An infinite straight-line bounded from one side is called a half-line (a ray) in one direction . ... One-mode . ... Optimal with respect to accuracy . ... Orthogonal with respect to the weight function $W(x)$ over the domain $\delta$ . ...

Еще в разделе: (Показать все результаты (>225) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. MNR1R_C. Задача безусловной минимизации функции многих переменных
• БЧА НИВЦ МГУ. IA80R_C. Аппроксимация рациональными функциями (равномерная)

... О Факультете . Новости факультета . ... Ученый совет . ... Студенческий Совет . ... УМС ?Реклама и связи с общественностью? УМС ?Журналистика? ... УМС ?Телевидение? ... Lomonosov Moscow State University Faculty of Journalismљ . The Second International Media Readings in Moscow . ... The registration form should be sent to the following e-mail address: moscow.readings@smi.msu.ru or be filled following this link . ... 2015 Факультет журналистики МГУ . ... Факультет журналистики МГУ feedback ...

Еще в разделе: (Показать все результаты (>46) - www.journ.msu.ru/ )

• The Second International Media Readings in Moscow
• Title :: Department of Journalism, M. V. Lomonosov Moscow State University
• International media readings :: Department of Journalism, M. V. Lomonosov

... Кадр . ... Переменные языка . ... Проблемы условных операций и принципа однократного присваивания в языке COLAMO . ... В рассматриваемом языке переменные языка Colamo разделяются по "способу хранения" на мемориальные (MEMory) , внутренней памяти (InterMem) , коммутационные (COMmutation) и регистровые (REGister) . ... Когда разрабатывался язык Colamo, на чипах ПЛИСов еще не было собственной (внутренней) памяти, поэтому сначала не был введен тип переменной, соответствующий хранению данных в ней. ...

257. Anton O. Belyakov

258. http://www.edst.msu.ru/conf/docs/USA-2002%2B.doc

259. http://www.library.biophys.msu.ru/PDF/80521.pdf

260. http://www.protein.bio.msu.ru/~akula/coherence.pdf