... Аннотированный каталог . ... Обмен ссылками . ... a target=_top href="http://abiturcenter.ru"> <img width="88" height="31" alt="Учебно-научный центр довузовского образования" src="http://abiturcenter.ru/images/unc2.gif" border="0"></a> . a target=_top href="http://abiturcenter.ru/izdat/"> <img width="88" height="31" alt="Издательство УНЦ ДО" src="http://abiturcenter.ru/izdat/izdat.gif" border="0"></a> . ... document.write ("<" + "script language='JavaScript' type='text/javascript' src='"); . ...

Еще в разделе: (Показать все результаты (>2) - www.abiturcenter.ru/ )

ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...

Еще в разделе: (Показать все результаты (>15) - antares.sinp.msu.ru/ )

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• ConClus

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>3) - pk.math.msu.ru/ )

• First Education | Mechmath admission for internetional students

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Registration . ... Edit registration info . ... Registration fee Pontryagin 2008 Conference, YOUR NAME . ... Most often you will need to indicate the intermediary bank (or Correspondent Bank) which is used to make an international transaction. ...

Еще в разделе: (Показать все результаты (>8) - pont2008.cmc.msu.ru/ )

To make visas please contact Olga I. Yakovenko . ... Date of birth: . ... Date of issue: . Date of expiration (your passports must be valid 3 months after the end of the sojourn in Russia): . ... Date of arrival in Russia: . Date of leaving Russia: . Single or multiple visa: . ... Location of the consulate where you will obtain the visa*: *) You are not obliged to come in the central Russian Consulate in your country for obtaining your visa. ... Visas to Russia . ... Information . ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>5) - ani.cs.msu.su/ )

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>3) - www.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>10) - e-journal.spa.msu.ru/ )

• Государственное управление. Электронный вестник

The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...

252. http://www.sai.msu.su/gcvs/gcvs/nl75/readme

253. Department of Mathematics, Faculty of Physics, Lomonosov MSU

254. InCo literature in English

255. http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf

256. www.99ru.ru

257. http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда