Regular Maps and Their Groups H. R. Brahana American Journal of Mathematics, Vol. ... In the one case the number of regions of the map is equal to twice the order of the group and in the other the number of regions is equal to the, order of the group divided by the number of sides of a region. ... The Group of a Regular Map. ... Noting that there exists no group of order 40 and degree 8, we have the result that there exists no regular map of ten 4-sided regions on - a surface of genus two. ...

Еще в разделе: (Показать все результаты (>34) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf
• http://dfgm.math.msu.su/files/papers-sym/conder.pdf

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

Nonlinear Dyn DOI 10.1007/s11071-014-1811-5 ORIGIN AL PA PER On the loss of contact of the Euler disk Alexey V. Borisov · Ivan S. Mamaev · Yury L. Karavaev Received: 25 October 2013 / Accepted: 13 November 2014 © Springer Science+Business Media Dordrecht 2014 Abstract This paper is an experimental investigation of a round uniform disk rolling on a horizontal surface. ... It is seen from Table 2 that the larger the mass of Euler's disk, the shorter the loss of contact with the surface before the stop. ...

Еще в разделе: (Показать все результаты (>100) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/94a/borisov2011.pdf
• http://ics.org.ru/upload/iblock/b7b/RCD190101.pdf
• http://ics.org.ru/upload/iblock/336/170-statistical-irreversibility-of-the-kac-reversible-circular-model_en.pdf

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• Key research directions
• Admission Regulation

... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...

Еще в разделе: (Показать все результаты (>25) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_4.doc

... Наука >> Астрономия >> Физика Солнца | Популярные заметки . Пятна на Солнце . ... Научная лаборатория школьников . ... К открытию массы нейтрино: "Первые результаты работы Нейтринной обсерватории Садбери." ... Русский Переплет . Первые результаты работы Нейтринной обсерватории Садбери: объяснение недостатка солнечных нейтрино и обнаружение новых свойств у нейтрино. ... С помощью космической обсерватории SOHO и сети наземных станций GONG обнаружен новый периодический процесс на Солнце. ...

Еще в разделе: (Показать все результаты (>193) - www.nature.web.ru/ )

• Астрокартинка дня: "Загадка в гамма-лучах"
• Астрономической картинке дня шесть лет!
• Доклиническая диагностика семейной гиперхолестеринемии с помощью анализа ДНК

... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...

Еще в разделе: (Показать все результаты (>13) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/korotaev_geophysical.pdf

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>9) - www.protein.bio.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Moscow State University is actively using various mechanisms for working with talented students , including Universiades, Olympiads and tournaments, scientific conferences and forums, science reading sessions, seminars and debates, research paper competitions, summer and winter science schools (including out-of-campus events), and round tables. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>17) - talant.msu.ru/ )

• The Department of Talented Youth Affairs and Professional Orientation |
• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional
• International School on IT- and GRID-technologies for young scientists | The

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>17) - www.library.biophys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Outreach . ... TEPA?2012 was held at Lomonosov Moscow State University, Russia. ... Workshop on ?Lomonosov? project held in Moscow State University, November, 28-30, 2011 . ... Current state of the project as a whole. ... Space vehicle status. ... Universitetsly-Tatiana-2?, and the space project ?Chibis?, being developed by Space Research Institute of RAS (IKI RAS) in collaboration with Moscow State University. ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

• Университетский спутник "Ломоносов" | Сайт университетского спутника ...
• Transient luminous events | Университетский спутник "Ломоносов"

Cosmic Research, Vol. 42, No. 5, 2004, pp. 489­534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509­554. Original Russian Text Copyright © 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• One of the informative characteristics of the reverse electron transport in the
• CURRICULUM VITAE

М. М. Бахтин и Л. С. Выготский: интериоризация как "феномен границы" . Джон Шоттер . ... Каждое высказывание вызывает отклик. ... Интересуясь, как взаимодействуют телесные существа, а не только отношениями между словами и концепциями, М. М. Бахтин принимает за основную лингвистическую единицу высказывание, а не грамматически правильно построенное предложение. ... Л. С. Выготский только намекает на сенсорную, или аффективную функцию слова, для М. М. Бахтина же она оказывается центральной. ...

Еще в разделе: (Показать все результаты (>7) - psyberlink.flogiston.ru/ )

• Abstracts, Cultural Mediation of National History and Identity, a session at
• Социальная психология

... Our Partners . ... URALCHEM Holding P.L.C., a company incorporated in Cyprus and the holding company for URALCHEM Group, one of the largest producers of nitrogen and phosphate fertilizers in Russia and the CIS. ... Thermodynamics center of precise calorymetry investigations.љ ... Facility for the Analysis of Chemical Thermodynamics ( Decterov S.A. љ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>4) - td.chem.msu.ru/ )

.. .. .. « » 01 -07 .., . «» 2010 532.516.532.517 35.114 43 43 « » 01 - 07 2010 . . . . «» ­ : . 2010. - 196. . . , . 532.516.532.517 35.114 © . .., 2010 XIX - () « » 1 7 2010 . «» . 60 , 14 . : ( ) , ( , ) . 42 30 . .. .. ­ .. , .. .. « ». . .. , .. , .. ( . ), .. , .. , .. (. ), .. , .. (. ) .. (. --). , 1976. . .. . , 30 «» - 3 , . .. (15 2009) .. (25 2008). , .. .. . - , . . . ..-.. .. 4 « » 1. .. . 2. .. . 3. .. ( , ) . 4. .., .., .., .. «» . 5. .. - . 6. .. . 7. .. - . 8. .. . 9. .., .., .. 5 . . 10.

Еще в разделе: (Показать все результаты (>14) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2010/inf-eng.doc
• http://hit-conf.imec.msu.ru/2012/abstracts/Shelistov_1.doc

Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...

Еще в разделе: (Показать все результаты (>22) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Carbon%20dots%20ND%20ppsc201300251.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...

Еще в разделе: (Показать все результаты (>5) - miles.sinp.msu.ru/ )