. The algorithm builds multiple alignment of conservative blocks and find consistent sets of helices. The input data may contain junk sequences. Department of Department of Bioengineering and Bioinformatics, MSU, Moscow, Russia . Mail to Andrey Mironov .

Еще в разделе: (Показать все результаты (>6) - bioinf.fbb.msu.ru/ )

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

Еще в разделе: (Показать все результаты (>2) - www.affp.mics.msu.su/ )

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

Еще в разделе: (Показать все результаты (>2) - www.fnm.msu.ru/ )

European Credit Transfer System: ECTS ECTS ECTS : ECTS ( ) ґ 1. ... ECTS - - EUROPEAN CREDIT TRANSFER SYSTEM: European Credit Transfer System (ECTS) ґ , , ґ , . ... ECTS , : (, , 2000 ), ? ( ґ)? (-, 2001 ), ? ? (, 2002 ), EUA ? ґ ? (, 2002 ) . 2003 ). ... 2004 ., ECTS? 2002-2010 . ... ECTS, 30 Z, (4 ) ґ 240 Z; (5 ) ґ 300 Z; (6 ) ґ 360 Z. , , , , . ... 1 ґ ( + ) b) ґ 60 1 c) , (: ґ 120; 180; ґ 240; ґ 300; ґ 360). ... http://www.rsvpu.ru/ects/ects.htm). ... ECTS, ? ? , , (http://www.mifp.ru). ...

Еще в разделе: (Показать все результаты (>4) - inpro.msu.ru/ )

• http://www.inpro.msu.ru/files/docs/Spes_innov_06_2007.pdf
• http://www.inpro.msu.ru/files/nmo/oop.pdf

... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...

Еще в разделе: (Показать все результаты (>6) - lab106.imec.msu.ru/ )

... Полная версия: OCTOPUS . Грация-МГУ::Форум > Мультимедия > Аудио . OCTOPUS . ... Artist : OCTOPUS . Mix : Session-4-Progression . ... URL : http://octopus.pdj.ru . ... Time : 31:49 min . ... International Pony - Gothic Girl (menses_club_mix) . ... Gui Boratto - ItТs Majik (dub) . ... 2. julian poker pres.re-construction - re-construction(d-formation rmx) . ... URL : http://octopus.pdj.ru/ http://octopus-online.livejournal.com/ . ... Chk Chk Chk - Heart Of Hearts (The Brothers mix) . ...

Еще в разделе: (Показать все результаты (>16) - grace.msu.ru/ )

• OCTOPUS - Грация-МГУ::Форум

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...

Еще в разделе: (Показать все результаты (>2) - kids.genebee.msu.ru/ )

Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...

Еще в разделе: (Показать все результаты (>16) - statsoft.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... On this page we collect references to our resources, documentation and resources on other sites. All these data are very helpful for everybody who wants to learn practical quantum chemistry. Firefly (PC GAMESS) main page . ... ERG group wrote some articles about visualization: . ... Нет комментариев " Quantum chemistry information page " . ... Quantum chemistry information page . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>55) - erg.biophys.msu.ru/ )

• ab initio ERG Research Group: Лаборатория теоретической биофизики
• Potential energy surface scanner ERG Research Group: Лаборатория теоретической
• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики

... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...

Еще в разделе: (Показать все результаты (>11) - kvartira-belogo.guru.ru/ )

... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...

336. http://dis.bio.msu.ru/States/Fursova_Mil'ko_2006_en.pdf

337. Useful links

338. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

339. Commission on Paleopedology Discussions

340. http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf