... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...
The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...
Опубликована Зверева И.М. «Нестандартные задания по ядерной физике для развития творческих способностей школьников» \\ Развитие творческих способностей по физике в условиях реализации образовательных стандартов: доклады научно-практической конференции - Изд-во МГОУ, Москва, 2013. - сс.25-29 Нестандартные задания по ядерной физике для развития творческих способностей школьников Зверева И.М., НИИЯФ МГУ Наши пятиклассники показали хорошие результаты в международном тестировании TIMSS в 2011 году. ...
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016 Похожие документы
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
... О факультете | ... Структура факультета . ... Научная жизнь . ... 495) 939-4461 . 495) 939-3749 . ... Виталий Третьяков считает, что телевидение должно иметь 'книжный фундамент', то есть опираться на традиционные культурные ценности человечества.. ... Новая жизнь нашей телестудии . ... Наша телевизионная студия начала новую жизнь! ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... Этот редактор незаменим в работе, имеет приятный и интуитивно понятный интерфейс и удобные настройки. Обладает широкими возможностями для поиска информации, сравнения и просмотра файлов в различных кодировках. ... Редактор имеет мощный ресурс и может быть полезен при работе с файлами большого объема. ... Скачал попробую очень трудно найти... хороший редактор который делал бы такие вещи.. ... Хороший редактор. ... 2.В сокращенном режиме работы (Редактор файлов) не работает обработка файла запроса. ...
... ald1r.zip . ... Вычисление решения с минимальной евклидовой нормой системы линейных алгебраических неравенств. ... H ищется вектор X минимальной нормы || ... SUBROUTINE ALD1R (G, MDG, M, N, H, X, XNORM, W, INDEX, IERR) . ... вещественный вектор длины N - в результате работы подпрограммы содержит решение (если IERR = 0); . ... IERR - . ... DATA MDG /3/, M /3/, N /2/ CALL ALD1R (G, MDG, M, N, H, X, XNORM, W, INDEX, IERR) Результаты: IERR: 0 Решение: 1.000E+00 1.000E+00 XNORM: 1.414E + 00 ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы
... Поиск одиночного рождения топ-кварка в эксперименте CMS. ... После достигнутого в 2012 году снижения систематической погрешности калибровки, на данных 2010-го года, полученных на коллайдере LHC в эксперименте CMS при соударении ионов свинца с энергией в системе центра масс 2,76 ГэВ на нуклон, измерена плотность потока энергии в передней области с помощью калориметра CASTOR (интервал псевдобыстрот с -6,6 по -5,2) для событий с разной степенью центральности соударений. ... B708 (2012) 21-26 ]. ...
[
Текст
]
Ссылки http://www-hep.sinp.msu.ru/hep/open_docs/lehep_otchet_2012.doc -- 1707.5 Кб -- 19.12.2012 Похожие документы
A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...