... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>57) - eng.geogr.msu.ru/ )

• Renewable Energy Sources

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>6522) - kodomo.fbb.msu.ru/ )

• allpy: log

... Liza Ceciel van Jaarsveldt is currently an Associate Professor in the Department of Public Administration and Management at UNISA. ... va Rooyen E.J., van Jaarsveldt L.C. A South African developmental perspective on e-government // Journal of Public Administration. ... Vol. ... Vol. 26 (2). van Jaarsveldt L.C. The need for public administration education to improve service delivery in the Information Society // Journal of Public Administration. ...

Еще в разделе: (Показать все результаты (>288) - ee-journal.spa.msu.ru/ )

... Determine type of branching, explain 3. Determine architectural model (use key from Halle et al. ... Determine phyllotaxis type and formula of spiral phyllotaxis (if applicable), explain 5. Write detailed description of leaf of each plant species (see plan below). ... Plan of leaf description: 1. General characters (leaf as a whole): (a) symmetry (symmetrical / asymmetrical); (b) stipules (present / absent, deciduous / not); (c) base (sheath / no, ligule /no, auricles /no) 2. ...

Еще в разделе: (Показать все результаты (>201) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Systema Naturae
• Publications about flora

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>131) - bioinf.fbb.msu.ru/ )

• SDPlight
• SDPsite - Algorithm Format requirements

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>5479) - monkey.belozersky.msu.ru/ )

• About authors ot this complex
• PDB entries containing domains of the family "POU domain, class 2, associating
• Homeodomain numeration assumed

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>22) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc

... Next: Article Batching Up: C-News Previous: The sys file . The active file is located in /usr/lib/news and lists all groups known at your site, and the articles currently online. ... Entries take the following form: newsgroup high low perm newsgroup is, of course, the group's name. low and high are the lowest and highest numbers of articles currently available. ... This group has been disabled locally. ... This marks newsgroup as being a local alias for another group, namely real-group. ...

Еще в разделе: (Показать все результаты (>285) - itpm.msu.su/ )

• The Linux Kernel (Copyright Notice)
• Module Index - Apache HTTP Server
• perchild - Apache HTTP Server

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>108) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | Teaching staff
• Effect of disulfide crosslinking on thermal transitions and chaperone-like
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>201) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Russian SETI
• Trip over old Shanghai

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DRIVER: To develop a model of the interstellar hydrogen distribution in the heliosphere. To apply this model for the analysis of experimental data from different spacecraft. ... The results of the simulations of the formation and evolution of molecular clouds can be used as initial conditions for the current star formation in galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>42) - hpc.msu.ru/ )

• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center

... Magnetiб? materials with magnetoelectric . ... Associate Professor, Ph.D. Research : The group performs studies of magnetoelectric interactions which provide the unique properties and multiple phase transitions in lanthanide magnetic materials. ... General Physics Institute, Russian Academy of Sciences (Moscow); . ... M.V. Lomonosov Moscow State University, Faculty of Physics, CKP, Laboratory of magnetic phenomena physics (119991 Moscow, Lenin Hills , 1, bld 35, room No. ...

Еще в разделе: (Показать все результаты (>28) - ferro.phys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

The PROBLEM of ELECTRON and SUPERLUMINAL SIGNALS V.P. Oleinik Monograph is published in "Nova Science Publishers, Inc. ... The electron as an open self- organizing system 1 1 1 1 1 1 Physical ideas and main results The model of open system Equations for the vortex and potential components of electromagnetic field The self- acting field of electron Interaction of the field of electron with vortex electromagnetic field Action of the system of interacting fields. ... Superluminal signals and STR 2- 9. ...

Еще в разделе: (Показать все результаты (>480) - chronos.msu.ru/ )

• A METHOD FOR DETERMINING ECOSYSTEM NORMAL FUNCTIONING REGIONS
• Determination analysis as a method for diagnostics of ecosystem condition
• Table 1

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>37) - erg.biophys.msu.ru/ )

• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• comcon1 ERG Research Group: Лаборатория теоретической биофизики

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>63) - brain.bio.msu.ru/ )

• Change-point synchronization in pairs of EEG channels

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>4) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . которая состоится 7-8 июня 2006 г. на базе . факультета иностранных языков и регионоведения . ... Дидактические принципы дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>14) - anazarenko.ffl.msu.ru/ )

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>57) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/nikitin/posterACAT2002.doc

... Nonlinear Transient Bubble Oscillations . ... The investigation considers issues associated with transient regime of nonlinear bubble oscillations. The nonlinear response of a gas bubble to a low frequency pumping wave results in parametrically-generated shape oscillations above a well-defined threshold. This may be detected through insonification of the bubble by a high-frequency imaging wave, leading to the subharmonic and fundamental combinations frequency signals. ...

Еще в разделе: (Показать все результаты (>375) - acs366.phys.msu.su/ )

• Abstract (Invited)
• General Information