... In many areas of physics, in particular, in gravitation and quantum field theory, to solve the physical problem one has to find solutions of nonlinear ordinary differential equations or systems of such equations. ... At the same time there exist methods, which allow to find special solutions of systems of ordinary differential equations in the form of elementary or elliptic functions, reducing the initial system to a system of nonlinear algebraic equations. ...

Еще в разделе: (Показать все результаты (>14792) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: [LCG-ROLLOUT] [EGI BROADCAST] Decommission of gridops.org
• [Comphep-common] Events to produce of LHAEF format
• Sergey Yurievich Vernov (Institute of Nuclear Physics, Moscow State University)

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>106) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial hypermagnetic helicity evolution, J. Cosmology and Astroparticle Phys., 06, 008, 2012. The hypermagnetic helicity density at the electroweak phase transition (EWPT) exceeds many orders of magnitude the galactic magnetic helicity density. ... This should be taken into account in scenarios of galactic magnetic field evolution with a cosmological seed. ...

Еще в разделе: (Показать все результаты (>72) - srcc.msu.ru/ )

• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial
• Leading scientific fellow Sergey Piskarev Ph.D.
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>6177) - kodomo.fbb.msu.ru/ )

• allpy: 5e7851709c95 lib/project.py
• allpy: 8565652a4019 lib/project.py
• allpy: log

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>32) - erg.biophys.msu.ru/ )

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>90) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• Performance Analyzer. Preliminary design
• Prefictor of DVM-program performance. Preliminary design

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>5459) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>215) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• Delivering News

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>169) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf
• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf
• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf

Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>299) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Russian SETI
• Trip over old Shanghai

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>227) - uneex.lorien.cs.msu.su/ )

• Real-World Package Building
• Module Index - Apache HTTP Server
• Conditionals

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>71) - uneex.mithril.cs.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>59) - acat02.sinp.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>166) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>75) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• Yurii Naumovich Lipsky

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>94) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Publications about flora

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>217) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2014sanya-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013mexico-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2012moscow-steklov-talk.pdf