... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>14) - cdfe.sinp.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>4819) - kodomo.fbb.msu.ru/ )

• allpy: log

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>63) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>104) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>44) - scon155.phys.msu.su/ )

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>28) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>133) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs
• Science
• About me

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>205) - uneex.lorien.cs.msu.su/ )

• Apache mod_rewrite Technical Details - Apache HTTP Server
• Conditionals
• Module Index - Apache HTTP Server

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>53) - uneex.mithril.cs.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>8) - erg.biophys.msu.ru/ )

.

35. Stopping and Restarting Apache

36. Leading scientific fellow Sergey Piskarev Ph.D.

37. Lib-DVM. Interface description

38. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

39. %TOPICTITLE% (15 vs. 19) - TWiki

40. Systema Naturae