The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>137) - hist.msu.ru/ )

. This is the complete list of member functions and enum types for QNPStream , including all inherited members. QNPStream . complete . end . instance . lastModified . okay . requestRead . seekable . setComplete . setOkay . type . url . write . ~QNPStream . Copyright © 1998 Troll Tech . Trademarks . Qt version 1.40

Еще в разделе: (Показать все результаты (>524) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>205) - uneex.lorien.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>64) - uneex.mithril.cs.msu.su/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>108) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• Yurii Naumovich Lipsky

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>8) - angel.cs.msu.su/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>546) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,
• rfbr:rest:jobschema [THEP]

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>117) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>13) - cdfe.sinp.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>5297) - kodomo.fbb.msu.ru/ )

• allpy: log

CALL for PAPERS . September 29-October 2, 2005 Boston University, Boston, Massachusetts, U.S.A. The Central Eurasian Studies Society (CESS) invites PAPER and ROUNDTABLE proposals for the Sixth CESS Annual Conference, September 29-October 2, 2005, in Boston, Massachusetts. ... Paper and roundtable proposals relating to all aspects of humanities and social science scholarship on Central Eurasia are welcome. ... Deadline for Submission of Paper and Roundtable Proposals: April 1, 2005. ...

Еще в разделе: (Показать все результаты (>73) - www.prof.msu.ru/ )

• Ensure your inclusion in the Dissertations in Central Asian Studies Webpage
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>45) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>129) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>130) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>218) - itpm.msu.su/ )

• The Network File System
• Kernel Options in 1.0 and Higher
• Choosing the Right Maps

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>53) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>102) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System