... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>30) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A
• МГУ - ЛОКЛЛ:: Закон Менцерата

Exact dynamics of duplications and mutations in whole genome sequences Maxim Koroteev, Jonathan Miller Physics and Biology Unit Okinawa Institute of Science and Technology (Graduate University), maxim.koroteev@oist.jp We introduce a family of models of sequence duplications and point mutations that reproduces steady state duplication length distributions of natural genomes, both eukaryotic and prokaryotic. ... 2011) Scale-free duplication dynamics: a model for ultraduplication, PRE, 84(061919). ...

Еще в разделе: (Показать все результаты (>162) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/149.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/167.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/181.pdf

в строке vstr, заменяет vpat на vrep ====== function replace(vpat,vrep,vstr) { var myindex=vstr.indexOf(vpat); var replen=vrep.length; if (myindex != -1) { var vstr1=vstr.substring(0,myindex)+vrep; var vstr_con=vstr.substring(myindex+replen); vstr1+=replace(vpat,vrep,vstr_con); return vstr1; } else { return vstr; } } function isEmpty( vdata ) { if ( vdata.length 0) { for ( var i=0; i vdata.length ; i++) { if ( ...

Еще в разделе: (Показать все результаты (>12) - genphys.phys.msu.su/ )

Generalized Maxwell Formula for the Length of a Minimal Tree With a Given Topology / Ivanov A.O., Tuzhilin A.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>23) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2010
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2011

... Attempt to optimize some properties of fluorescent chimeras of human small heat shock protein HspB1 by modifying linker length and nature. ... Chimerical proteins consisting of enhanced yellow fluorescent protein (EYFP) connected by linkers of different length and nature to the N-terminal end of small heat shock protein HspB1 were obtained and characterized. ... Long flexible linkers should be used to obtain fluorescent chimeras with chaperone-like properties similar to those of the wild-type HspB1....

Еще в разделе: (Показать все результаты (>28) - biochem.bio.msu.ru/ )

Next: SYSTEM CALL: msgctl() Up: 6.4.2 Message Queues Previous: SYSTEM CALL: msgget() . ... To deliver a message to a queue, you use the msgsnd system call: . ... The first argument to msgsnd is our queue identifier, returned by a previous call to msgget . ... The msgsz argument contains the size of the message in bytes, excluding the length of the message type (4 byte long). ... The fourth argument ( mtype ) specifies the type of message to retrieve from the queue. ...

Еще в разделе: (Показать все результаты (>103) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - E Known errors and design
• MySQL Reference Manual for version 3.23.10-alpha. - SQL command, type and
• mod_deflate - Apache HTTP Server

... Figure 3.8: Measurement of curve length. Curve Mode allows to measure the length of curve lines. ... To delete a curve point a cursor at the start point of of the curve (marked by green rectangular) and press the Left Button of the Mouse. If you point the Mouse at any point of the curve and press the Left Button, then a part of the curve after this point will be deleted. ... To draw a new curve instead continuing the old one hold Ctrl button while clicking the left mouse button. ...

Еще в разделе: (Показать все результаты (>28) - www.spm.genebee.msu.ru/ )

• Isolines
• AFM OF RNA AND RNA-PROTEINS COMPLEXES

... However, a competing process of micelle formation (see Figure) reduces efficiency of the copolymers as stabilizers. ... We have developed a theory of micelle formation in solution of AB and AC diblock copolymers. ... Despite a number of theoretical studies in the field of micelle formation in solutions of diblock copolymers with a charged block, the problem of equilibrium distribution of counterions was not considered properly. ... PSMTLab . ... Chair of Polymer and Crystal Physics; . ...

Еще в разделе: (Показать все результаты (>80) - polly.phys.msu.ru/ )

• Selected publications of Ivanov, Viktor Alexandrovich
• International Workshop "Theory and Computer Simulation of Polymers: New

Mitigating Activity of Humic Substances and their Si-enriched Derivatives in relation to Wheat Seedlings under Salt-Stress Condition Olga I. Philippova1, Natalia A. Kulikova1, Leonid A. Karpiouk2, Galina F.Lebedeva1, Irina V. Perminova 1 2 Department of Soil Science, Lomonosov Moscow State University, 119992, Moscow, Russia, Department of Chemistry, Lomonosov Moscow State University, 119992, Moscow, Russia philippova@soil.msu.ru 2 Keywords: humic, bioactivity, silicium, stress 1. ...

Еще в разделе: (Показать все результаты (>74) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2009/2009-philippova-biological.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kholodov-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2005/kholodov-enchanced-2005.pdf

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>9) - bioinf.fbb.msu.ru/ )

• Input Formats
• RNA kinetics server
• RNA Kinetics: Result explanation

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-3.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out

. WINAMP . playlist . 11 tracks in playlist, average track length: 44:56 . Playlist length: 8 hours 14 minutes 19 seconds . Playlist files: DJ Skinner-Purple rose . m-NuClEaR - gobble-mix. HH2!!s . Nuclearsound . prick . m-NuClEaR - remember stritz . set . threedays . tssf-05171999-m3-gabbergirl . tssf-19990222-gabbergirl . tssf-19990422-Ozone-3-Gabbe . tssf-19990531-m3-gabbergirl . tssf-19991001-switchcraft-vandenbroek-56k . tssf-19991004-mcubed-gabbergirl . tssf-1999-djspree-mixtapeAside .

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

• Миксы и Мегамиксы.

... MPI_Graph_get . Retrieves graph topology information associated with a communicator #include "mpi.h" int MPI_Graph_get ( comm, maxindex, maxedges, index, edges ) MPI_Comm comm; int maxindex, maxedges; int *index, *edges; . ... All MPI routines (except MPI_Wtime and MPI_Wtick ) return an error value; C routines as the value of the function and Fortran routines in the last argument. ... A common error is to use a null communicator in a call (not even allowed in MPI_Comm_rank ). ... Центры . ...

Еще в разделе: (Показать все результаты (>153) - www.parallel.ru/ )

• MPI_Info_get_valuelen | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Cart_coords | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Scatterv | PARALLEL.RU - Информационно-аналитический центр по параллельным

... MRAM). ... 14.1, IBM, . 2006 3.5 200 , , 2004 - 100 . 14.1. ... 14.5. (bit length) (bit width) . ... 100 . ... LIMDOW (Light Intensity Modulated Direct OverWrite - ). LIMDOW- , . LIMDOW 100% . ... MRAM - magnetic/magnetoresistive random access memory) , , , , . MRAM, RAM(Random Access Memory). ... MRAM RAM (SRAM) RAM (DRAM) - RAM, . ... bit lines) (word lines) ( . ... MRAM IBM, , Siemens, Motorola, Philips, Hewlett Packard, Hitachi. ... Motorola 1 Mb MRAM, [2]. ...

Еще в разделе: (Показать все результаты (>52) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/MagNanoS/L9.pdf

... Accepted input types are: A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. ... Sequences are expected to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, U and * are acceptable letters (see below). ...

Еще в разделе: (Показать все результаты (>101) - www.genebee.msu.ru/ )

• FASTA format description
• GeneBee BLAST 2.2.22+ Services Help
• Notes on searching by similarity

... This hypothesis is tested using fluid inclusions studies on mineral samples from three Allihies Mines, and quartz veins and a calcite related to a carbonatite intrusion at Black Ball Head. ... classify and compare the different fluid inclusion types hosted in quartz and calcite; . ... Type 1 and Type 2 inclusions occur at both the Allihies and Black Ball Head localities and are hosted by both quartz and calcite, whereas Type 3 inclusions are restricted to the host mineral quartz. ...

Еще в разделе: (Показать все результаты (>402) - geo.web.ru/ )

• Informal geological society (RSG SG )

Fo cal Stability Charles Pugh Department of Mathematics, University of Toronto, Toronto, Canada e-mail: cpugh@math.utoronto.ca Generically, how many geodesic loops of the same length originate at a common point? ... Abraham's Bumpy Metric Theorem and its proof by Anosov play a role, as does our focal stability conjecture. This last is a kind of structural stability conjecture for the focal decomposition of the generic exponential map. ... In some cases we have verified the conjecture. ...

39. http://www.mce.biophys.msu.ru/archive/doc150820/eng.pdf

40. Brandenburg A., Sokoloff D., Subramanian K., Current status of turbulent dynamo