A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>221) - www.genebee.msu.ru/ )

• Picornaviruses: discovering big in small
• Bioinformatics portal, Moscow State University
• The GeneBee Group

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>13) - belyakov.imec.msu.ru/ )

... Sternberg Astronomical Institute, Moscow State University , . ... Moscow 119992, . ... Phone: +7 (495) 9391626 . Fax: +7 (495) 9328841 . ... Россия, Москва 119992, Университетский проспект 13 . ... Welcome to my home page. I am a research fellow at Sternberg Astronomical Institute of Moscow State University. ... Page changed by Irina Mironova 12/02/2010 ...

Еще в разделе: (Показать все результаты (>11004) - crydee.sai.msu.ru/ )

• V.A.Baturin - Home Page at Sternberg Astronomy Institute, MSU
• E.V.Kononovich
• Lecturing list

M. A. Vorotyntsev 1 1,2,3, D. V. Konev3, M. Skompska 4 ICMUB-UMR 6302 CNRS, Universite de Bourgogne, Dijon, France 2 M. V. Lomonosov Moscow State University, Russia 3 Institute for Problems of Chemical Physics, Chernogolovka, Russia 4 University of Warsaw, Poland mivo2010@yandex.com, mv@elch.chem.msu.ru, mv@u-bourgogne.fr In situ measurements of specific conductivity of films on electrode surface Specific conductivity: function of potential Impedance problems: 1. ... Which thickness? ...

Еще в разделе: (Показать все результаты (>103) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/kuznetsov/chizmadgev.pdf

Hybrid Molecular Mechanics : For Effective Crystal Field Method for Modeling Potential Energy Surfaces of Transition Metal Complexes M. B. DARHOVSKII/-2 M. G. RAZUMOV/ A. L. TCHOUGREEFF12 1 3 I. V. PLETNEV,2' 4 L. Y. Karpov Institute of Physical Chemistry , Moscow , Russia 2 Center for Computational Chemistry at the M. V. Keldysh Institute/or Applied Mathematics of RAS, Moscow , Russia 3N. S. Kurnakov Institute of General and Inorganic ... 2002 Wiley Periodicals, Inc. ...

Еще в разделе: (Показать все результаты (>47) - analyt.chem.msu.ru/ )

• Moscow State University: Analytical Chemistry Division

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>110) - www.msm.biophys.msu.ru/ )

• Modern spectroscopy methods

International Laser Center of MSU . ... Lecture courses . ... SPIE student chapter . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... Home Education Laser Graduate School . The International Laser Center of Moscow University is the organizer of annual sessions of the Laser Graduate School. ... For students of Moscow University, these short courses is a part of their regular lecture courses. ...

Еще в разделе: (Показать все результаты (>797) - ilc.phys.msu.ru/ )

• IV International Symposium Modern Problems of Laser Physics MPLP'2004
• Laboratory of theoretical problems in optics
• Laboratory of Quantum Information

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>10) - www.fbm.msu.ru/ )

The International Conference and Exhibition "Molecular and Nanoscale Systems for Energy Conversion" (MEC-2007)" Moscow, RUSSIA, October 1 - 3, 2007 The main purpose of the Conference is to bring together the world leading specialists in chemistry, chemical physics, biophysics and biotechnology that deal with the energy conversion problems in both basic research and technological areas Conference subjects: . ... Catalysis for energy conversion . ... Emanuel Institute of Biochemical Physics RAS . ...

Еще в разделе: (Показать все результаты (>523) - phys.msu.ru/ )

• http://phys.msu.su/rus/news/latest/poster.pdf
• Russian-Singapore forum at M.V.Lomonosov Moscow State University
• Физический факультет МГУ им. М. В. Ломоносова

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Egor Frantsevich Cancrin and the Problem of Serfs in Russia, . ... Ezhegodnik (Economic Hystory. ... Egor Cancrin (1774-1845) - the Russian Minister of the Finance (1823-1844) - played a key role in the development and realization of the economic policy of Russia, especially currency reform in 1839-1843. ... The three versions of his abolition project (1818, 1826, 1836) are reviewed in the article. Cancrin emphatically disputed against the landless redemption of the peasants. ...

Еще в разделе: (Показать все результаты (>478) - hist.msu.ru/ )

• Russia and Western Countries: Economic Relations Before World War I and the
• The Center for Theoretical Problems in the Historical Sciences
• Department of Russian History of the 20th Century

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>19) - imaging.cs.msu.ru/ )

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>33) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Laboratory of Ferroelectricity

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>158) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• Gol'dman N. L. Inverse problems with final overdetermination for quasilinear

... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... The problem of innovation development on the basis of higher education institutions is urgent both for Russia and for other countries, in light of modern concepts of national innovation systems, such as the triple helix model by Henri Etzkowitz which is used as theoretical basis for the analysis of innovation development mechanisms presented in this paper. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>569) - ee-journal.spa.msu.ru/ )

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>98) - qilab.phys.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>173) - www.journ.msu.ru/ )

• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University

... About CIE MSU . ... Useful Information . ... Vestnik CIE (in Russian) . ... Moskva, IPA: [m? skva]) the capital of Russia and the country s principal political, economic, financial, educational, and transportation center, located on the Moskva River. the city s population of 10.4 million permanent inhabitants within the city boundaries constitutes about 7% of the total Russian population. ... Moscow s road system is centered roughly around the seat of the Russian government, the Moscow Kremlin. ...

Еще в разделе: (Показать все результаты (>290) - www.cie.ru/ )

• About Lomonosov Moscow State University :: CIE

... The circumnuclear GASEOUS disks are often decoupled from the circumnuclear stellar disks and are even stronger inclined to the outer disk planes; in fact, we have found a considerable `population' of inner polar rings. Inner gas polar rings are found as in spiral galaxies with the massive outer gas disks co-planar to the main symmetry planes (e.g. NGC 2841, Sil'chenko et al. 1997, and NGC 7217, Sil'chenko & Afanasiev 2000) as well in many lenticular galaxies (Fig. ...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/postbr2.pdf