... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with   algorithms applied to examples origin from an   exhaust system. ... The model equations are determined   by conservation of mass, momentum and energy. In addition there exists an equation of state   for the ideal gas system. ... Applying computer algebra to   these model equations, we demonstrate that   solutions can be derived. ...

Еще в разделе: (Показать все результаты (>51) - acs366.phys.msu.su/ )

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>11) - seac47-2.phys.msu.ru/ )

LangueDOC . ... Languages . ... Archi . ... The phonetic system of Archi is very rich, and the writing systems that are familiar to Archi speakers (Russian cyrillic and Avar cyrillic) are not sufficient for recording all sounds of the language. ... Kibrik et al. 1977] ? the notation used in this dictionary is given in the comparative table below under the label "1977"; [Kibrik, Kodzasov 1990]), but they were too difficult for the Archi speakers to learn and therefore remained inaccessible to them. ...

Еще в разделе: (Показать все результаты (>174) - www.philol.msu.ru/ )

• LangueDOC :: Tools :: Text conversions

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>3) - www.sciencepark.ru/ )

• MSU Science Park - Venue & Space

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>135) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• AliComp - GeneBee Alignments Comparison - Advanced
• GeneBee service

Thursday, June 24th, 2010 . ... Wednesday, June 16th, 2010 . На сайт добавлен пакет Lightbox 2.04 (http://www NULL .huddletogether NULL .com/projects/lightbox2/) (by Lokesh Dhakar) для отображения графики с дополнительными визуальными эффектами: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for June, 2010. ... Наши публикации . ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>4) - geo.sai.msu.ru/ )

• Lightbox 2 Лаборатория лазерной интерферометрии
• site lightbox Лаборатория лазерной интерферометрии
• Uncategorized Лаборатория лазерной интерферометрии

Astronomy Picture of the Day . NGC 5307: A Symmetric Planetary Nebula . ... 31.12.1997 . ... Credit: H. Bond ( STScI ) R. Ciardullo ( Penn State ), WFPC2 , HST , NASA Explanation: Some stellar nebulae are strangely symmetric. ... NGC 5307 is an example of a planetary nebula with a spiral shape. ... December 1997 . ... U. Based on Astronomy Picture Of the Day . Publications with keywords: planetary nebula . Publications with words: planetary nebula . ... NGC 3132: The Eight Burst Nebula . ...

Еще в разделе: (Показать все результаты (>3025) - www.astronet.ru/ )

• High Noon Analemma Over Azerbaijan
• XWare > APOD
• Journal "Peremennye Zvezdy"

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>48) - imaging.cmc.msu.ru/ )

ChangeLog for snakes # # Generated by Trac 0.12.5 # 04/11/16 22:55:00 Mon, 20 Dec 2010 14:01:39 GMT Daniil Alexeyevsky me.dendik@тАж [134:8e75e931bfd2] * snakes / example.snake ( modified ) example.snake : better rules for chasing enemy tail Mon, 20 Dec 2010 11:57:44 GMT Daniil Alexeyevsky me.dendik@тАж [121:06e4b4ea7596] * snakes / example.snake ( modified ) * ...

Еще в разделе: (Показать все результаты (>383) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=360c297c05f3577ca730ecaf86131163456f6b73&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=138%3A416418c9aaef&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=416418c9aaefbd75f3451a63f12d0ab8af3b89f3&limit=100&mode=stop_on_copy

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>10) - lhe.sinp.msu.ru/ )

. ? mfs = 0.7 cm . ? hsfa = 0.8 cm . D sun_slit = F ? (2?) [rad] [cm] . (F mfs = 13500 mm, F hsfa = 35000 mm) . A procedure for calibrating fits images from Ondrejov Multichannel Flare Spectrograph .

Еще в разделе: (Показать все результаты (>95) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR
• IDL programs
• FITShdr: INSTALL

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>7) - hit-conf.imec.msu.ru/ )

... Alechin , Vasilii Vasilievich (1884-1946) . Alexeev , Eugeni Borisovich . Bobrov , Andrej Evgenievich . ... Ehrhart , Friedrich (1742-1795) . Goldbach , Carl Ludwig (1793-1824) . ... Juzepczuk , Sergei Vasilievich (1893-1959) . Karavaev , Mikhail Nikolaevich ( 1903-1992 ) . Khokhrjakov , Andrej Pavlovich (1933-1998) . Kuvaev , Vladimir Borisovich . ... Linnaeus , Carl, fil. ... Sokoloff , Dmitry Dmitrievich . ... Tzvelev , Nikolai Nikolaevich . ... Phone/fax: 7 (095) 939-2777 . ...

Еще в разделе: (Показать все результаты (>80) - herba.msu.ru/ )

• INTERNATIONAL SYMPOSIUM
• Alders in the European Russia
• The employment of quantitative methods for the lake ecosystem research

Название статьи И.О. Фамилия11,a, И.О. Фамилия22,b 1 Название института и полный адрес, например: Московский государственный университет имени М.В.Ломоносова, физический факультет, кафедра общей физики. ... Title in English I.O. Pervyiavtor1,a , I.O. Vtoroiavtor2,b 1 Название института и адрес на английском языке, например: Department of [.. ... Moscow 119991, Russia. 2 Название института и адрес на английском языке, например Sternberg State Institute of Astronomy, Moscow State University. ...

55. XAFS Publication Database search form

56. Public administration. Web journal

57. Gaussian Cube files loader ERG Research Group: Лаборатория теоретической

58. Fortran DVM language description

59. Visual Energy Level Plot