Image warping as an image enhancement post-processing tool Andrey Krylov, Alexandra Nasonova, Andrey Nasonov Abstract A method to improve the results of image enhancement is proposed. The method is based on pixel grid warping, the main idea is moving pixels in the direction of the nearest image edges. ... In this work we present a new post-processing algorithm for image deblurring with enhancement of edge sharpness. ... The result of image warping is highly dependent on the input edges. ...

Еще в разделе: (Показать все результаты (>304) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/Deinterlacing08.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• http://imaging.cs.msu.ru/pub/2009.ICIP.Krylov_Lukin_Nasonov.IntEdgePres.en.pdf

Number of cores used . ... Standard MP4(SDTQ) benchmark, Wall clock time and relative speedup . ... Intel Quad Core 2.83 GHz Q9550 CPU on an Asus P5Q board (Intel P45 chipset), 4x4 GB DDR-2 800 MHz RAM (total 16 GB), 2x 640 GB Samsung SATA-2 hard disks configured as software RAID-0, Linux Opensuse 64-bit kernel 2.6.25.18-0.2-default. ... Harpertown performance comparison page . ... Press to visit PC GAMESS v. 7.1 performance and scalability on 16-core Intel Tigerton (Xeon X7350)-based system page . ...

Еще в разделе: (Показать все результаты (>82) - classic.chem.msu.su/ )

• PC GAMESS v. 7.0.4: Opteron Rev. E vs. Opteron Rev. F performance comparison
• PC GAMESS vs. WinGamess performance comparison
• PC GAMESS: Woodcrest vs. Opteron performance comparison

The Journal "Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...

Еще в разделе: (Показать все результаты (>101) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

Doklady Biological Sciences, Vol. 375. 2000, pp. ... GENERAL BIOLOGY Specific Structural Features of the Pectoral Arch and Phylogenetic Relations in Some Mammalian Taxa S. V. Fomin and V. S. Lobachev Presented by Academician I.A. Shilov March 6, 2000 Received March 6, 2000 Reorganization of the pectoral arch has played an important role in mammalian evolution. ... Thus, the formation of two types of pectoral arch in the modern families of Lagomorpha could only have occurred through divergence. ...

Еще в разделе: (Показать все результаты (>53) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/MOLBIOL_2007_Raddei_eng.pdf

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Еще в разделе: (Показать все результаты (>132) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Laboratory of Difference Methods | CMC MSU
• Laboratory of Difference Methods

Liana N. Sviridova . ... B.B.Damaskin, E.V.Stenina, L.N.Sviridova. ... Russ. ... V. A. Safonov, M. A. Choba, M. A, L. N. Sviridova E. V. Stenina, Peculiarities of the Adsorption Behavior of Adamantanol-1 on a Mechanically Renewable Silver Electrode. ... V.A.Safonov, M.A.Choba, A.G.Krivenko, L.N. Sviridova, E.V.Stenina Time effects at the adamantanol-1 adsorption on silver electrode. ... E. V. Stenina, L. N. Sviridova, B. B. Damaskin Adsorption of Lanthanum and Thorium Cryptates at Mercury Electrode. ...

Еще в разделе: (Показать все результаты (>69) - electr003.chem.msu.ru/ )

• Elena V. Stenina: Selected Publications
• Leonid V. Pugolovkin: Selected Publications
• Victor A. Safonov: Selected Publications

... P300 Based Brain Computer Interface: The Effect of the Stimulus Position in a Stimulus Train I. P. Ganin, S. L. Shishkin, A. G. Kochetova, and A. Ya. ... However, the P300 based BCI has some specific fea tures. ... 2) In the modified P300 based BCI paradigm with moving stimulus positions, triple trial presentation of stimulus was associated with a higher amplitude of the P300 component in response to the first target stimu lus compared to the responses to the second and third stimuli. ...

Еще в разделе: (Показать все результаты (>54) - brain.bio.msu.ru/ )

• http://brain.bio.msu.ru/papers/Byeon_Kaplan_Timashev_Vstovskii_Park_2007_HumPhysiol_AutocorrelationStructure_EEG_Schizophrenia_Adolescents_eng.pdf
• http://brain.bio.msu.ru/papers/Borisov_Kaplan_Gorbachevskaya_Kozlova_2005_HumPhysiol_SchizophrStructSynchr.pdf
• http://brain.bio.msu.ru/papers/Kaplan_Levichkina_2009_HumPhysiol_Unconscious_Context_Control_Visual_Perception_of_Simple_Stimuli_eng.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>63) - chaos.phys.msu.ru/ )

UNDERSTANDING SPOKEN DISCOURSE: THE CONTRIBUTION OF THREE INFORMATION CHANNELS 1 Andrej A. Kibrik (Institute of Linguistics, Russian Academy of Sciences, kibrik@comtv.ru) Ekaterina M. хl'bert (CJSC GLITNIR Securities, ekaterina_elbert@inbox.ru) Modern linguistics generally presumes that linguistic form is a sequence of phonological segments. ... We thus tentatively split all elements that can possibly convey information in discourse into three channels: visual, prosodic, and verbal (=segmental). ...

Еще в разделе: (Показать все результаты (>257) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~rlc2010/abstracts/rlc2010_abstracts_sem30.pdf
• http://www.philol.msu.ru/~rlc2010/abstracts/rlc2010_abstracts_sec15.pdf
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/ramaglia.pdf

... The laboratory of Quantum Information and Quantum Optics (QIQO) was organized in the summer of 2006 on the basis of Spontaneous Parametric Down-Conversion laboratory. It was designated to work on specific topics in the new field of quantum information and quantum communication. ... Possible applications - development of quantitative methods to analyze the degree of entanglement of two-photon states, as well as engineering of specific states for quantum information and communication purposes. ...

Еще в разделе: (Показать все результаты (>140) - qi.phys.msu.ru/ )

Here is the new version of catalog originally created and developed by S. Melgunov. Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'N' . ... Wiley Interscience ] . not defined] . ... Taylor Francis Group ] . ... Nature . Nature Publishing Group ] . ... Nature Cell Biology . ... Nature Reviews Molecular Cell Biology . ... New Zealand Native Orchid Group Orchid Journal . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>208) - journals.genebee.msu.ru/ )

• JCatalog - Different journal alphabetic indexes

... The project was initiated by Edward Boos, Viacheslav Ilyin and Victor Savrin. ... The main author of the CompHEP software is Alexander Pukhov. ... The program produced a code for calculation of squared diagrams, written in the Reduce symbolic manipulation language. ... In 1991 CompHEP got the built-in symbolic manipulation package created by A. Pukhov and the Fortran code output written by A. Pukhov and S. Shichanin [ 10 ]. ... They also contribute to and are responsible for debugging the package. ...

Еще в разделе: (Показать все результаты (>1933) - theory.sinp.msu.ru/ )

• [Computer_algebra] Fw: CA Seminar on December 24
• calg:dubna07:abstracts [THEP]
• Polar vectors

The Journal "Vestnik Moskovskogo Universiteta. ... Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...

Еще в разделе: (Показать все результаты (>66) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of

DVM debugger . Detailed design . ... 1.1 The ?Dynamic control of DVM-directives? method . ... 1.3 The ?Comparing execution results? method . ... 4 Base modules implementation . ... 5 Dynamic control of DVM-directives . ... 5.6 Dynamic control of DVM directive implementation . 5.6.1 Use the table of variables by dynamic control module . 5.6.2 Base functions of dynamic control module . ... 6.5.5 Trace comparing module . ... The messages of dynamic control of DVM-directives . ...

Еще в разделе: (Показать все результаты (>83) - sp.cs.msu.ru/ )

• Logic and Databases
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• DVM debugger. Preliminary design

ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-08/02 23 June 2008 STUDY OF THE RESPONSE OF THE NEMO-KM3 DETECTOR INSTRUMENTED WITH DIRECTION-SENSITIVE OPTICAL MODULE M. Anghinolfi1 , M. Bersani1 , K. Fratini1 , V. Kulikovsky2, M. Osipenko1, A. Plotnikov2, E. Shirokov2, M. Taiuti1 , S. Zavatarelli1 ... Physics, Moscow State University, 119899 Moscow, Russia Abstract We studied the performances of the underwater neutrino telescope NEMO-KM3 ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf
• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>134) - elana.sinp.msu.ru/ )

• contro la legge.- non ha niente che comprendono l?originale e non durature | С
• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Posters Order images | ... Our original posters are printed on Kodak Metal Archive paper using the Epson STYLUS Pro 9500 plotter. ... The exposed paper is processed using RA-4 chemistry yielding the highest quality photographic print available. Because these posters are imaged using precision light onto photographic paper, color accuracy from print to print is ensured as well as the vibrant and true colors found in the original transparency. ... Kamchatka. #arkam0018 . ... EcoPhoto Imagery . ...

Еще в разделе: (Показать все результаты (>94) - www.fadr.msu.ru/ )

• Untitled
• SPECIAL ISSUE OF CATENA «RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS»
• Abstracts

.

Еще в разделе: (Показать все результаты (>53) - lav01.sinp.msu.ru/ )

... An important feature of such media, compared to homogeneous media, is the occurrence of wave scattering when the wavelength becomes comparable to a characteristic size of the micro-structure (bead diameter). Wave scattering leads to mode conversion between compression and shear waves, and, under some conditions, leads to diffusion of acoustic waves. ... We also observed self-demodulation of shear pump waves into both shear and compression secondary waves. ...

Еще в разделе: (Показать все результаты (>171) - acs366.phys.msu.su/ )

• Abstract (Invited)