Every time when we are trying to create a model containing a massive vector particle we meet a problem caused by bad asymptotics of its propagator . ... The problem mentioned above is solved in the framework of gauge field theories where the gauge symmetry is responsible for mutual cancellation of rapidly growing contributions of separate diagrams [ Bjorken&Drell ]. ... Indeed, in the case of t'Hooft-Feynman gauge the propagator of vector particle takes the form . ... Let vector have the components . ...

Еще в разделе: (Показать все результаты (>276) - theory.sinp.msu.ru/ )

• Gauge symmetry and cancellations
• Regularization
• [RU-NGI] need hekp

... Exceptions . ... The C++ language interface for MPI includes the predefined error handler MPI::ERRORS_THROW_EXCEPTIONS for use with the Set_errhandler() member functions. ... If a non-C++ program causes an error that invokes the MPI::ERRORS_THROW_EXCEPTIONS error handler, the exception will pass up the calling stack until C++ code can catch it. ... The error handler MPI::ERRORS_THROW_EXCEPTIONS causes an MPI::Exception to be thrown for any MPI result code other than MPI::SUCCESS . ... Центры . ...

Еще в разделе: (Показать все результаты (>289) - www.parallel.ru/ )

• Starting jobs with a debugger | PARALLEL.RU - Информационно-аналитический центр
• Error Handlers | PARALLEL.RU - Информационно-аналитический центр по
• Clarification of Error Behavior of Attribute Callback Functions | PARALLEL.RU -

... Abstract Pseudomonas aeruginosa is one of the most significant pyoinflammatory pathogens which can cause severe suppurative complications and even lead to lethal outcome. The wide use of carbopenemes, that are "the last defence line" after penicillin and cephalosporin-based beta-lactame antibiotics, brought to the appearance of Pseudomonas aeruginosa stains with high resistance level to these antibiotics. ... Moscow University Chemistry Bulletin . 2006, Vol. ... Copyright (C) Chemistry Dept., ...

Еще в разделе: (Показать все результаты (>190) - chem.msu.ru/ )

• [На предыдущий раздел]
• Moscow University Chemistry Bulletin Vol. 51, No. 3, P. 215 (2010)
• Moscow University Chemistry Bulletin Vol. 48, No. 3, P. 178 (2007)

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Inorganic Synthesis . ... Four families of superconductors were obtained and characterized; thay are the so-called family of 1111 with the general formula LnOFeAs (Ln – rare earth metal), the 122 family – AEFe 2 As 2 (AE = Ca, Sr, Ba and Eu (II)), the 111 family – AFeAs (A = Li, Na), and the 011 family – FeSe. ... In the 1111 phases, such blocks have the fluorite structure (LnO); in 122 they are alkaline earth metal cations AE(2), in phases of the 111 family they are alkali metal cations Li and Na. ...

Еще в разделе: (Показать все результаты (>11) - www.inorg.chem.msu.ru/ )

new-mac ]] . ... Instructions for Installing CompHEP under OSX . ... Be aware, that Mac OS ix not Linux, installation of any GNU (or GNU-based) software can cause problems! ... go to Fink ( http://fink.sourceforge.net/ or any other GNU software repository), download the fink application and БЂњFink CommanderБЂќ, and then use this to download the binary files for: gfortran (fortran 77 compiler) . download the last version of the software from the comphep web site, http://comphep.sinp.msu.ru . ...

Еще в разделе: (Показать все результаты (>4) - comphep.sinp.msu.ru/ )

This module provides for sending files which contain their own HTTP headers. ... Module Identifier: asis_module . This module provides the handler send-as-is which causes Apache to send the document without adding most of the usual HTTP headers. ... In the server configuration file, associate files with the send-as-is handler e.g. AddHandler send-as-is asis The contents of any file with a .asis extension will then be sent by Apache to the client with almost no changes. ... HEAD> . ...

Еще в разделе: (Показать все результаты (>49) - neptun.sai.msu.ru/ )

• Stopping and Restarting Apache
• Apache HOWTO documentation
• Connections in FIN_WAIT_2 and Apache

ASTEROIDAL DAMAGE TO THE EARTH: IMPLICATIONS BY ASTEROIDS ­ RUBBLE PILES. ... 13, Moscow 119892, Russia, E-mail:san@sai.msu.ru In the cause of asteroids ­ rubble piles its effective cross-section of collision to the Earth is determined not by consolidated body, but by cluster of its fragments. Since the stage of rubble ­ piles may be ~108 years (see our communication at previous symposium), it may be significant for estimation the asteroidal damage to the Earth. ...

Еще в разделе: (Показать все результаты (>45) - selena.sai.msu.ru/ )

• Comments on the regular wave planetology
• Бережной А.А.

... 3 Basic «metaphisics» Systemic nature of morphological disparity (BD) BD structure is interrelation among BD forms Structural approach to BD investigation implies analysis of interrelations among BD forms Systemic nature of BD presumes that interrelations among BD forms are in part causal At least some of BD forms could constitute a part of causulities affecting certain properties of some other BD forms 4 Basic «metaphisics» ...

Еще в разделе: (Показать все результаты (>585) - zmmu.msu.ru/ )

• Morphofunctional interpretation of the quills stridulating in tenrecs
• Geographical pattern and historical demography of Midday gerbil Meriones

I.B. Konovalov, M. Beekmann, I.N. Kuznetsova, A. Yurova, A.M. Zvyagintsev. Atmospheric impacts of the 2010 Russian wildfires: Integrating modeling and measurements of an extreme air pollution episode in the Moscow region. Atmospheric Chemistry and Physics. 2011. ... 10031-10056. Numerous wildfires provoked by an unprecedented intensive heat wave caused continuous episodes of extreme air pollution in several Russian cities and densely populated regions, including the Moscow region. ...

Еще в разделе: (Показать все результаты (>35) - srcc.msu.ru/ )

• Tatiana V. Amotchkina, Sebastian Schlichting, Henrik Ehlers, Michael K.

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>65) - www.kosmofizika.ru/ )

• Open Preprints

... This button switches the current on. 2. to induce - to change continually or frequently. ... Wood is a poor conductor of heat. 4. to line up with - to cause to have a large amount of e.g. work to deal with.. ... His feelings fluctuated between excitement and fear. 6. putative -- smth that acts as a path for electricity, heat. ... Attitudes to the question are changing albeit slowly. 10. to chime with - to change slightly, esp. to make right or make suitable for a particular purpose or situation. ...

Еще в разделе: (Показать все результаты (>9) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf

... It has also been the subject of a number of theoretical projects concerning how zygotic expression is controlled by maternally-derived spatial signaling gradients, in particular how hb is activated by the Bicoid (Bcd) gradient. ... By optimizing the model to Hb expression data (constrained by experimental data for regulatory TFs), we found parameter sets which produced robust hb expression despite high variability in maternal input factors (Bcd and maternal Hb (Hb mat )). ...

Еще в разделе: (Показать все результаты (>81) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/227.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/229.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/158.pdf

This document covers stopping and restarting Apache on Unix only. ... Then the parent itself exits. Any requests in progress are terminated, and no further requests are served. ... The USR1 signal causes the parent process to advise the children to exit after their current request (or to exit immediately if they're not serving anything). ... The status module will also use a G to indicate those children which are still serving requests started before the graceful restart was given. ...

Еще в разделе: (Показать все результаты (>267) - rtm-cs.sinp.msu.ru/ )

• Bzip2 mini-HOWTO
• Linux SMP HOWTO
• Apache HOWTO documentation

. CMS experiment . Azimuthal anisotripy in HIC with CMS Tracker ******************************************** *************************************

Еще в разделе: (Показать все результаты (>18) - lav01.sinp.msu.ru/ )

... I.N.Modin. ... Pervago E.V., Bobachev A.A., Modin I.N., Shevnin V.A. Report, presented at Annual SAGEEP conference, April 1995, Orlando, Florida, USA. 1 p. RESISTIVITY PROSPECTING IN URBAN REGIONS . ... Bobatchev A.A., Modin I.N., Pervago E.V., Sapognikov B.G., Shevnin V.A. Resistivity method, old and new . ... Volkov S.I., Kolarov D.L., Modin I.N., Muller A., Pervago E.V. Experience of aquatorial electrical survey at Brandenburg land in Germany. 3rd Meeting environmental and engineering geophysics....

Еще в разделе: (Показать все результаты (>22) - www.geol.msu.ru/ )

• Support

The global Fulbright alumni community joins people of good will throughout the world in grieving for the loss of life and for the devastation caused by the earthquake and tsunamis that struck Indonesia, Sri Lanka, India, Thailand, and other countries. Fulbright alumni and current grantees have asked if Fulbrighters in the region were harmed. The U.S. Department of State has informed us that no U.S. Fulbright grantees in the affected area were killed or injured in the disaster. ...

Еще в разделе: (Показать все результаты (>45) - www.prof.msu.ru/ )

Title Authors Key words Liberalism ­ neoliberalism ­ market fundamentalism: from the concept of freedom to the totalitarian dogma V.I. Chelischev fundamentalism, market fundamentalism, ideology, socio-economic and sociopolitical crisis, liberalism, individualism, freedom, "laissez-faire", the dogmatic style of political thinking The article analyzes the causes of the extensive socio-economic and sociopolitical crisis captured almost all countries of the world. ...

Еще в разделе: (Показать все результаты (>23) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/10.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/03.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/05.pdf

Detection of Primary Stages of Intravascular Blood Coagulation by Acoustic Methods Uzlova S.G., Guria K.G.1, Shevelev .A., Vasiliev S.., ... National Hematology Research Centre, Novii Zykovskii 4, Moscow, 125167, Russia, +7(499)761-13-71, E-mail: uzelokk@mail.ru 1 Moscow Institute of Physics and Technology Abnormalities of blood coagulation cause serious pathological complications. ... As a result local coagulation associated with inflammation, oncology or vascular disease can remain unnoticed. ...

Еще в разделе: (Показать все результаты (>26) - www.msm.biophys.msu.ru/ )

• MSM 2007

... The observation that it is the choice of the prefix that influences the grammaticality can be confirmed by the fact that the other verbs of transfer (with the same prefixes) show the same patterns of grammaticality. (12a) On privel s soboj celyj polk soldat. (12b) On uvel s soboj celyj polk soldat. (12c) On vyvel s soboj celyj polk soldat. (12d) ? ... First, we propose that the function of `s soboj' is to modify the resultant state of the predicate (along the lines of Ramchand 2003). ...

Еще в разделе: (Показать все результаты (>181) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/files/Navajo_dative_2_BI@SSILA_2001.pdf