... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>75) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/240809/Pavlovsky.pdf
• http://nuclphys.sinp.msu.ru/mirrors/2001_2c.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_15.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Align tool for DNA-protein complexes

Diploma thesis abstract Ultrashort laser pulses in the mid-infrared range generated by guided-wave optical parametric amplification Student: Poroykova K.A. Supervisor: Zheltikov A.M. In the diploma work modern method of generation of the ultrashort MIR-pulses based on optical parametric amplification in the hollow waveguide filled with xenon is studied. ... It results in the nonstationary phase matching in single point and therefore in effective few-cycle pulse generation. ...

Еще в разделе: (Показать все результаты (>126) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2014/Mamaeva_Saveliev_en.pdf
• Публикация
• Publication

Giant Second-Harmonic Generation Enhancement in the Presence of Tamm Plasmon-Polariton B.I. A finog enov , V.O. Bessonov, and A.A. Fedyanin Lom onosov M oscow St at e Uni versit y, 1 Leni nski e gory, 119991, M oscow, Russi a afi nogenov@nanolab.phys.m su.ru Abstra ct: Giant enhancement of the second harmonic generation in metal/photonic cr ystal (PC) system obser ved in the vicinity of Tamm plasmon-polariton resonance due to str ong electromagnetic field localization at the metal and PC inter face. ...

Еще в разделе: (Показать все результаты (>45) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/thg_in_fishnet.pdf
• Static and ultrafast nonlinear optics of metamaterials | Laboratory of
• Alexander S. Shorokhov | Laboratory of Nanophotonics & Metamaterials

Sequence alignment of non-superposable beta-sheets Evgeniy Aksianov Belozersky Institute, Lomonosov Moscow State University, Leninskie Gori 1, Moscow, Russia, evaksianov@gmail.com Andrey V. Alexeevski Belozersky Institute, Lomonosov Moscow State University, Scientific Research Institute for System Studies (NIISI RAN), Moscow, Russia aba@belozersky.msu.ru Protein 3D structures usually are more conserved than their sequences. ... Beta-strands are contained in sheet map rows. ...

Еще в разделе: (Показать все результаты (>137) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/179.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/104.pdf

... 32Bits Online: because there's more than one way to compute . New about new versions of computer related stuff . AAA Matilda Web Search . ... Search . ... The Music Database . ... Musicians looking for other musicians (Free Service) . ... The Mac Game Database uses PHP and MySQL . ... Bioinformatics databases at the Montreal Children's Hospital using MySQL . ... DSL providers search with reviews Made with MySQL and Modperl, all pages are generated dynamically out of the MySQL database . ...

Еще в разделе: (Показать все результаты (>185) - itpm.msu.su/ )

• mod_expires - Apache HTTP Server
• mod_ext_filter - Apache HTTP Server
• Getting Acquainted with NIS

... Vol. ... Влияние рыночных отношений на организацию университетских исследований в канадских университетах: по данным опросов преподавателей в 1974-1983 и 1989-1998 гг. Ключевые слова: Высшая школа в условиях рыночной экономики. ... 2002. ... Исследовательская работа университетов США в целях национальной обороны. Ключевые слова: Наука в университетах. ... Ключевые слова: Связь университетов с промышленностью. ... Ключевые слова: Роль университетов в жизни общества. ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ...

Еще в разделе: (Показать все результаты (>38) - srcc.msu.ru/ )

• H.Zhang, D.Moss, N.Kleeorin, K.Kuzanyan, I.Rogachevskii, D.Sokoloff, Y.Gao,

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>91) - astro.uni-altai.ru/ )

Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>59) - sp.cs.msu.ru/ )

Heat transfer intensification on surfaces with 'eddy generating' relief by subsonic incident flow velocity . ... Scheme of unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . Unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . ...

Еще в разделе: (Показать все результаты (>4) - termogaz.imec.msu.ru/ )

• supersonic dimples_e
• Numeric_e
• scientific results_e

International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...

Еще в разделе: (Показать все результаты (>70) - ilc.phys.msu.ru/ )

• Публикация
• Grant detail
• "Lasers and nonlinear optics" practical course laboratory

The rise and fall of the fourth quark-lepton generation M.I.Vysotsky ITEP QFTHEP, Repino, June 26, 2013 M.I. Vysotsky The rise and fall of the fourth quark-lepton generation June 26, 2013 1 / 17 Prehistory 1974, J / (cc) discovery, "November Revolution" Ї c quark - the last member of the 2nd family (c, s, µ, µ ) 1976, -lepton, 1978; (bЇ) b the 3rd family 1994 - t-quark, but already in the 1980s - why only 3 generations? where is the fourth generation? ... Vector generation - another story.. ...

Еще в разделе: (Показать все результаты (>58) - qfthep.sinp.msu.ru/ )

• June 26, 2013

KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...

Еще в разделе: (Показать все результаты (>26) - old.philol.msu.ru/ )

... High Brightness RTM . ... Techniques to generate short, small emittance electron bunches of several nC at energies of several MeV are being developed to drive free electron lasers, for accelerator research, to provide short laser Thomson scattering X-ray pulses, and to generate intense coherent millimeter radiation (e.g., synchrotron, transition, etc.) ... Generating several tens of MeV beams now requires large, expensive, energy inefficient accelerators available only at large laboratories. ...

55. APPLICATIONS: Optics and Quantum Electronics | Moscow University Supercomputing

56. http://www.geogr.msu.ru/cafedra/geom/uchd/materialy/spetzkurs/ispolzovanieMDZ.pdf

57. Apache module mod_expires

58. Прием заявок на конференцию "Managing by Values - beyond Cultures and

59. http://genphys.phys.msu.su/rus/lab/mech/chapter1.pdf

60. Supernova 2007uy and 2008D in NGC 2770