... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>23) - nanofluidics.phys.msu.ru/ )

... The implementation of CanIt Pro at Apollo Hosting began when its president, Tamara Field saw the solution in action for another company.Roaring Penguin CanIt was running on our own systems we realized it was definitely the right choice, says Don McLeman, VP of operations at Apollo. switching to CanIt, 50 to 70 percent of my staffs time was spent getting servers white listed and handling customer complaints in regards to spam. 1.4 to 1.8 million messages a day are filtered. ... cheap ray bans . ...

Еще в разделе: (Показать все результаты (>68) - elana.sinp.msu.ru/ )

• such as you move the Zune HD and iPod touch | С Днем Победы!
• cheap ralph la | С Днем Победы!
• cheap north face How to Spot Counterfeit Tommy Hilfiger | С Днем Победы!

... In this article we considerљcalculationљof discrete Laplacian for 1D arrays usingљpython/numpy/scipy. We introduceљthe sparse matrix technique that is rather efficient for computation of certain types of diffusion PDE. ... 1 комментарий " Constructing discrete Laplacian via sparse matrix " . Reaction-diffusion systems in 2D space with python ERG Research Group: Лаборатория теоретической биофизики написал (Январь 26th, 2016 2:13 пп) . ... Constructing discrete Laplacian via sparse matrix . ...

Еще в разделе: (Показать все результаты (>9) - erg.biophys.msu.ru/ )

... Start from the camp inland towards 11 pine-trees ( Pinus sylvestris ), that are marked by notches. ... Further on there grows crowberry ( Empetrum hermaphroditum ), also marked by two notched trees. Then turn to the right, get deeper into the forest and reach bilberry-bushes ( Vaccinium myrtillus ), growing around a notched pine-tree. ... Walk about 50 metres to the left along the edge and then enter the forest. There are birches ( Betula pubescens ), marked by notches. ... phase . ...

Еще в разделе: (Показать все результаты (>156) - herba.msu.ru/ )

• Materials of A. Shipunov
• Moscow State University, Geobotany dpt. - View Staff
• Moscow State University, Geobotany dpt. - Courses

... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... July 8, 2012 . ... May 10, 2012 . The entrance control of cable system of scientific equipment ?Lomonosov? successfully completed. ... Input control tests of scientific equipment ?Lomonosov? devices is held in NIIEM. December 15, 2011 . Preparations for testing the dynamic module of scientific instruments for satellite ?Lomonosov? is finished. November 30, 2011 . ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

... Я позвонила на факультет, где мне рассказали о существовании дистанционных курсов. ... На выбор именно дистанционной формы обучения повлияла удобная форма отчетности и более полный объем материала по сравнению с заочными курсами, а также возможность получать результаты выполненных работ в более короткий срок. ... Undoubtedly it was made with great professionalism and, as it seems, care for people who are eager to study and take as much as their heads can store. ...

Еще в разделе: (Показать все результаты (>19) - anazarenko.ffl.msu.ru/ )

• Экзамен 2002 года

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>76) - ffl.msu.ru/ )

• Иностранным гражданам
• About Us

Kluwer Academic Publishers, attn. Annelies Kersbergen, P.O. Box 17, 3300 AA Dordrecht, The Netherlands, Telephone: (0)78-6576215, Telefax (0)78-6576388 Consent to Publish & Transfer of Copyright | For the mutual benefit and protection of Authors and Publishers it is | ... written Consent to Publish and Transfer of Copyright before publication of the| Work. The signed Consent ensures | that the Publisher has the Author's permission to publish the relevant | Contribution. ...

Еще в разделе: (Показать все результаты (>93) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-bezuglova-beneficial.pdf
• MGUMUS -- Kirk Hatfield

. Skip to main content . You are not logged in. ( Login ) . Тесты на проверку уровня знания английского языка . Управляющий: Bogdana Vyacheslavovna Kaznadzey . Учитель: Liliya Shaykhlislamova . Учитель: Lyudmila Georgievna Sizykh . Учитель: Людмила Георгиевна Сизых .

Еще в разделе: (Показать все результаты (>10564) - moodle.ffl.msu.ru/ )

• moodle: Разное

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/phylogeny/Species_set1.doc
• http://mouse.genebee.msu.ru/phylogeny/Species_set2.doc
• http://mouse.genebee.msu.ru/phylogeny/Species_set3.doc

. Сontacts . Home ? User account . Create new account . Log in . Request new password (active tab) . Username or e-mail address * . Selection committee . Site map . Site search . MSU website . Contacts . Contests . Application for participation . Facebook . vKontakte . Twitter . YouTube . This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. All rights reserved.

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

devel:main ]] . CompHEP . Trace: main . ... Community contributions . Community model library . ... CompHEP team . License . ... Installation guide . MAC OS installation . CompHEP-3.3 Manual . CompHEP-3.3 Manual (pdf) . ... CompHEP on the Web . Physics with CompHEP . CompHEP at LHC . ... Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported . ...

Еще в разделе: (Показать все результаты (>23) - comphep.sinp.msu.ru/ )

• extra:model:main [CompHEP]
• news [CompHEP]
• devel:stat [CompHEP]

... Information for the applicants . Contact information . ... Bioengineering and bioinformatics? Applicants who passed entering exams with the highest scores are free from any tutorial fees (state-funded). ... The annual FBB tutorial fee is 261 600 rubles per academic year. ... 119234, Moscow, GSP-1, Leninskiye Gory, MSU, 1-73, . Faculty of Bioengineering and Bioinformatics, office 433. ... MSU information office +7 (495) 939-10-00 . ... 2016 Faculty of Bioengineering and Bioinformatics, . ...

Еще в разделе: (Показать все результаты (>2) - en.fbb.msu.ru/ )

• Information for the applicantsтАФ Faculty of Bioengineering and Bioinformatics,

... The name IE2DP1 means: Integral Equation (method of decision), 2D (dimension), P (point current electrodes), 1 - across inhomogeneities. IE2DP1 program fulfills two dimensional (2D) electric field modeling for different modifications of resistivity and induced polarization (IP) field techniques. ... Apparent chargeability is saved always in the file "IE2DP1.RES" and reference point is in current electrode location. ... Number of angular points for one body more than 40 5. ... Run file "start.bat". ...

Еще в разделе: (Показать все результаты (>52) - geophys.geol.msu.ru/ )

• TRF_2d. Page 4.
• TRF_2d. Page 3.
• TES. Visualization

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . tags . Правка . Недавние изменения . Настройки . On the right you can see the tag cloud for this blog. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:16 2015

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

... Interaction classes . ... List of Contact Types: . ... Contact with Major Groove of DNA by helices, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by strands, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by helices, loops . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by loops . ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

... Three representative parameters characterizing the solar activity are sunspot number (W), 10.7cm radio solar flux (F10.7) and mean solar magnetic field value (SF). ... Practically persistent time series of these parameters are appropriate data sets for modelling and forecasting by means of Artificial Neural Networks (ANN). Methods of optimization of ANN input data sets and selection of training, testing and examination sets are discussed in the paper. ...