... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>6) - hcs.cmc.msu.ru/ )

The Fastdiag dynamic library (fastdiag.dll of Windows PC GAMESS/Firefly distributions, fastdiag.ex of Linux distributions) contains fast optimized modern algorithms of symmetric matrix diagonalization and inversion and is intended to improve the performance of initial guess generation, DIIS extrapolation, as well as some other computationally-intensive steps. ... However, DC-based code requires large amount of extra memory. ... It is usually as fast as kdiag=-1 but requires as much memory as kdiag=0. ...

Еще в разделе: (Показать все результаты (>39) - classic.chem.msu.su/ )

• PC GAMESS/Firefly sample input file - relaxed surface scan in DLCs
• PC GAMESS/Firefly DOCUMENTATION - Cube files

V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...

Еще в разделе: (Показать все результаты (>35) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/photos/achievements/asa_2013.pdf
• http://acoustics.phys.msu.su/conf2002.htm

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

In situ 3/04/2012 1 d =- i ( i d i ) d = + d ln s () ~ 1015 /2 ~ 10-9 /2 2 - . ... a = -2g 3 Furier-transformed infrared spectroscopy (FTIRS) ґ - - In situ - : - second harmonic generation (SHG) ґ ; - surface enhanced Raman scattering (SERS) ґ () Electromodulation infrared spectroscopy (EMIRS) ґ Subtraction normalized infrared spectroscopy (SNIFTIRS) ґ c Surface enhanced infrared absorption spectroscopy ( SEIRAS ) ґ 200 ґ 4000 -1 350 ґ 800 4 ...

Еще в разделе: (Показать все результаты (>44) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf

Department of Physics, Lomonosov Moscow State University . ... We need both good experimentalists and theorists, that want to work, to acheive this difficult goal. ... Molecular transistor based on a Scanning Tunnel Microscope tip (Laboratory of Cryoelectronics 1996) . ... Division of Atomic Physics, Plasma Physics, and Microelectronics . E: This email address is being protected from spambots. You need JavaScript enabled to view it. ... Faculty of Physics . ...

Еще в разделе: (Показать все результаты (>6) - cryolab.phys.msu.ru/ )

• Nikolay V. Porokhov
• Alexander G. Maresov

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>4) - discours.philol.msu.ru/ )

• Summer School Archives

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

Sign in Register . ... Resources . ... info@ecfs.msu.ru . All contacts . ... Home Resources Projects CIMMYT Informa 1855 . 06 October 2015 . Climate change figures prominently in todayтАЩs Informa, with reports on how the phenomenon will affect maize farming in southern Africa and on efforts to generate heat resilient maize for Asia. Researchers in Africa also attended training on how to breed for insect resistance in maize. ... To leave a comment you must log in or register . ...

Еще в разделе: (Показать все результаты (>9) - ecfs.msu.ru/ )

Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>8) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102

... Полная версия: Поколение 70х . Грация-МГУ::Форум > Общение > Литература . ... Мая 25 2007, 01:57 . Поскольку на форуме есть люди, которые любят читать литературу на языке оригинала, предлагаю вашему вниманию справочник молодежного сленга тех годов. http://www.inthe70s.com/generated/terms.shtml . Вверху страницы есть также ссылки на 80е и 90е года. ... Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда . ...

Еще в разделе: (Показать все результаты (>16) - grace.msu.ru/ )

• Поколение 70х - Грация-МГУ::Форум

... Home . ... Linguistic expeditions . ... People . ... Photogallery: Kislokan , Evenkia, July-August 2008 . Kislokan . Kislokan at sun - set . Kislokan after the rain . A Foggy morning in Kislokan . ... Kislokan helicopter landing site. ... People of Kislokan . ... The first medical help (Nadezhda Leonidovna Gayanchuk and Anatoliy Petrovich Mongo) . People of Kislokan with their dogs . ... Anatoliy Petrovich Mongo . ... Students participated in the expedition . ...

Еще в разделе: (Показать все результаты (>6) - lcl.srcc.msu.ru/ )

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Symposia

CUDA Center of Excellence NVIDIA 22 ? ? ґ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - ? ? : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>51) - geophys.geol.msu.ru/ )

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... Input parameters Key parameters: - sqrt(s), GeV N events ґ total number of events A number of target/projectile B min, B max ґ impact parameters (in fm) for all events Choice of parton-hadron conversion scenario (AMPT model, AMPT with string and others) Parameters for Lund fragmentation Quenching flag (on\off) K short decay flag, other flags Output parameters Output file: ampt.dat, containts: Event number Impact parmeter Total number of participants n. in proj. ...

Еще в разделе: (Показать все результаты (>37) - lav01.sinp.msu.ru/ )

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out