... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Structure

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>186) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - View Staff

SURNAMES OF THE ASTRONOMERS IN THE NAMES OF THE LUNAR OBJECTS. ... Sternberg State Astronomical Institute, Moscow University, Moscow, Russia The whole complex information about toponymy, morphology, selenographical coordinates and dimensions of the lunar objects was included in the automated information system for the Lunar Nomenclature. ... You may receive more detailed information in the Russian version of this article (nomen.pdf). ...

Еще в разделе: (Показать все результаты (>75) - selena.sai.msu.ru/ )

• Шевченко Владислав Владимирович

... XML. ... Regular path queries with constraints. pages 122-133, 1997. ... Susan Davidson, Gerd Hillebrand, and Dan Suciu. A query language and optimization techniques for unstructured data. ... Peter Bimeman, Susan B. Davidson, Mary F. Fernandez, and Dan Suciu. ... Constraints for semistructured data and XML. ... Peter Buneman, Mary F. Fernandez, and Dan Suciu. UnQL: a query language and algebra for semistructured data based on structural recursion. ... A query language for XML. ...

Еще в разделе: (Показать все результаты (>41) - new.math.msu.su/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>61) - ecfs.msu.ru/ )

• The Department of land resources | ECFS
• The structure of the ECFS | ECFS

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>40) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_db

... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 8th, 2016 4:27 дп) . ... All-atom automatic OPLS-AA topology generator . ...

Еще в разделе: (Показать все результаты (>20) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики

... NetCDF User's Guide for C . ... 2 - Components of a NetCDF Dataset . ... 2.4 - Attributes . ... 3.1 - netCDF external data types . ... 7.5 - Write a Single Data Value: nc_put_var1_ type . ... 7.10 - Read a Single Data Value: nc_get_var1_ type . ... 7.12 - Read an Array of Values: nc_get_vara_ type . 7.13 - Read a Subsampled Array of Values: nc_get_vars_ type . 7.14 - Read a Mapped Array of Values: nc_get_varm_ type . ... 7.16 - Fill Values . ... 8.4 - Get Attribute's Values:nc_get_att_ type . ...

Еще в разделе: (Показать все результаты (>16) - angel.cs.msu.su/ )

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>35) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/pose/talk.doc
• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc

... О физическом факультете . ... Главная / О факультете / Подразделения факультета / Научные центры / Пакет LabView . Фирма National Instruments передала в дар МГУ (физический факультет) пакет лицензионного программного обеспечения LabView (с дополнительными модулями), которое может быть свободно использовано для учебно-научных целей на факультете. Для получения копии пакета просьба обращаться к Михееву Павлу Михайловичу (тел. 939-41-48, e-mail: mikheev@femto.phys.msu.ru ), зав. ...

Еще в разделе: (Показать все результаты (>349) - phys.msu.ru/ )

• Обеспечение учебного и научного процессов на факультете лицензионным
• Администрация
• Title

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>57) - comet.sai.msu.ru/ )

• Structure of the file system
• The Structure of HTML 3.0 Documents
• Digitized Sky Engines

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>11) - observ.pereplet.ru/ )

... Continental Lithosphere Beneath SE Brazil . ... CREST (Continental Rifts: Evolution, Structure and Tectonics) Project . Crust and Upper Mantle Structure of S. California . ... Surface wave dispersion and upper mantle structure beneath southern Germany . ... Tomographic P-wave velocity inversion for the crust and upper mantle structure beneath Alaska . ... Upper Mantle Velocity and Q Structure . ... Velocity structure and anisotropy of the crust and upper mantle in the Brooks Range, Alaska . ...

Еще в разделе: (Показать все результаты (>18) - sbmg.geol.msu.ru/ )

• Sonenshain
• China

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>19) - nano.msu.ru/ )

... Geography of World Economy . ... Physical Geography and Landscape Science . ... Structure . ... Field stations . ... Type of field courses . ... The Faculty of Geography is the largest scientific and educational centre of geography in the world. ... The Faculty consists of 15 specialized departments, 8 research laboratories and 4 field stations, where 800 employees work. The Faculty of Geography also has 8 research laboratories.There are 3 branches of the faculty: in Sevastopol, Astana and Geneva. ...

Еще в разделе: (Показать все результаты (>105) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics

... PbTe, SnTe, GeTe and their solid solutions are narrow-gap semiconductors widely used in infrared optoelectronics and for thermoelectric energy conversion. ... The present work is a continuation of recent EXAFS studies performed at the NSLS on GeTe, SnTe and PbTe crystals doped with high concentration of indium (10-35 at.% ... The studied samples were PbTe, SnTe and GeTe doped with 1.5-2% of indium along two sections (InTe and In 2 Te 3 ) of the phase diagrams. ... Results of data analysis. ...

Еще в разделе: (Показать все результаты (>101) - scon155.phys.msu.su/ )

• An EXAFS study of the local structure of the PbxSn1-xS solid solution
• Ferroelectric - superconductor structures
• Time evolution of an incommensurate structure of Rb2ZnCl4 in uniaxial

. Parent Directory . Anciency/ . Christianity/ . Europe/ . Linguistics/ . RussianCulture/ . ivanov-bibl-eng.doc . ivanov-eng.html . ivanov.html . lidov.html . staff.html

Еще в разделе: (Показать все результаты (>17) - imk.msu.ru/ )

• Index of /Structure/Linguistics
• Index of /Structure/Linguistics/yakubovich
• Index of /Structure/Anciency

... Effect of mutations mimicking phosphorylation on the structure and properties of human 14-3-3zeta. ... Effect of mutations mimicking phosphorylation on the structure of human 14-3-3zeta protein was analyzed by different methods. Mutation S58E increased intrinsic Trp fluorescence and binding of bis-ANS to 14-3-3. ... Thus, mutation mimicking phosphorylation of Ser58 destabilized, whereas mutation of Ser184 induced stabilization of 14-3-3zeta structure. ...

Еще в разделе: (Показать все результаты (>48) - biochem.bio.msu.ru/ )

• Structure, properties, and probable physiological role of small heat shock
• Structure and properties of K141E mutant of small heat shock protein HSP22
• Structure, properties, and functions of the human small heat-shock protein

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...