... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>36) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect
• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A
• МГУ - ЛОКЛЛ:: Закон Менцерата

General Information . ... Symposium expenses . ... Presentation information . ... Travel information . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... From metro station "Belorusskaya" (green line) travel to metro station "Teatral'naya" (green line). ... From metro station "Paveletskaya" (green line) travel to metro station "Teatral'naya" (green line). ... After that make a change to "Biblioteka imeni Lenina" (red line) and travel on to metro station 'Universitet' (red line). ...

Еще в разделе: (Показать все результаты (>2) - ged.chem.msu.ru/ )

... The River Zelenchuk . ... Belgorod region . The Church in L'viv (Ukraine) . ... Voronezh, Russia) . ... the Voronezh sea . ... The River Tisa (Rahiv, . Zakarpattja, Ukraine) . Divnogor'e and the River Don . Voronezh region) . ... November, Voronezh) . ... April, Divnogor'e) . Spring snow . The khutor in Belgorod region . ... on the snow . ... Return . ...

Еще в разделе: (Показать все результаты (>51) - selena.sai.msu.ru/ )

. Green beam. Sunset in Black sea

Еще в разделе: (Показать все результаты (>31) - chaos.phys.msu.ru/ )

• Science

... 1978 May, Woods (Intel) 16 dRAM . 1979 Ziegler, Landford (IBM) , 106 e- 1 ґ SEU (Upset). ... 2005 RISC- (RAD750) IBM - Bae Systems 106 - 60 +125 0 200 Curiosity ( ). 200 000 greens. ... 2,54 (100 ) Al. ... 12. - (e-h) , 100 / N (t = 200 ) 2- . ... 50 100 N- 175 100 e-h . ... 200-800 ~ 1000 2***. ... INCL4Liege (. 33), ~ 60 /c , 180 /c. E*(t) , , . ... 270 Hs ( ~ 20 ) 4 GSI, . ... 45. (e-h ), SV1 1 - (800 ) p + 184W W- , . ... SEE-, ' Geant4. , , . ... 48. ґ 180 p + 27Al, () Geant4 ( ) Geant4 ( ). ...

Еще в разделе: (Показать все результаты (>50) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/MagNanoS/L14.pdf
• http://danp.sinp.msu.ru/MagNanoS/L9.pdf

arxiv:0907.4155 Зеленые горошины из Зоопарка Галактик: обнаружение класса галактик с экстремальным звездообразованием (Galaxy Zoo Green Peas: Discovery of A Class of Compact Extremely Star-Forming Galaxies) . ... Authors: V. Beckmann et al. arxiv:0907.0294 Измерения диффузного гамма-излучения на промежуточных галактических широтах по данным Fermi LAT (Fermi LAT Measurements of the Diffuse Gamma-Ray Emission at Intermediate Galactic Latitudes) . ... Authors: Beth Willman . ... Authors: Gerson Goldhaber ...

Еще в разделе: (Показать все результаты (>97) - astro.uni-altai.ru/ )

... K.G. Zolina, V.E. Kudryashov, A.N. Turkin, A.E. Yunovich, S. Nakamura. Luminescence Spectra of Superbright Blue and Green InGaN/AlGaN/GaN Light Emitting Diodes . ... A.E. Yunovich, V.E. Kudryashov, S.S. Mat. ... S.S. Mamakin, A.N. Turkin, A.N. Kovalev, F.I. Manyakhin. ... A.E. Yunovich, V.E. Kudryashov, S.S. Mamakin, A.N. Turkin, A.N. Kovalev, F.I. Manyakhin. ... Electroluminescence spectra of ultraviolet light-emitting diodes based on p-n-heterostructures InGaN/AlGaN/GaN coated by phosphors. ...

Еще в разделе: (Показать все результаты (>34) - scon155.phys.msu.su/ )

• New methods of measuring photoelectric parameters of silicon
• EXAFS study of PbS-SnS solid solution

в строке vstr, заменяет vpat на vrep ====== function replace(vpat,vrep,vstr) { var myindex=vstr.indexOf(vpat); var replen=vrep.length; if (myindex != -1) { var vstr1=vstr.substring(0,myindex)+vrep; var vstr_con=vstr.substring(myindex+replen); vstr1+=replace(vpat,vrep,vstr_con); return vstr1; } else { return vstr; } } function isEmpty( vdata ) { if ( vdata.length 0) { for ( var i=0; i vdata.length ; i++) { if ( ...

Еще в разделе: (Показать все результаты (>24) - genphys.phys.msu.su/ )

• Общий физический практикум
• Молекулярная физика
• Оптика

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ TSUNAMIGENIC POTENTIAL OF SUBMARINE EARTHQUAKES IN DIFFERENT REGIONS IN THE PACIFIC Viacheslav K. Gusiakov Institute of Computational Mathematics and Mathematical Geophysics, Siberian Division, Russian Academy of ... Fig. 1 shows the positions of 10 main tsunamigenic regions in the Pacific. ...

Еще в разделе: (Показать все результаты (>17) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E03_Didenkulova_Peli.pdf

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

• Input Formats
• RNA kinetics server
• RNA Kinetics: Result explanation

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

• http://theorphys.phys.msu.ru/education/aqft_slides/Handout1.pdf
• Advanced Quantum Field Theory

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>31) - acoustics.phys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-3.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out

. WINAMP . playlist . 11 tracks in playlist, average track length: 44:56 . Playlist length: 8 hours 14 minutes 19 seconds . Playlist files: DJ Skinner-Purple rose . m-NuClEaR - gobble-mix. HH2!!s . Nuclearsound . prick . m-NuClEaR - remember stritz . set . threedays . tssf-05171999-m3-gabbergirl . tssf-19990222-gabbergirl . tssf-19990422-Ozone-3-Gabbe . tssf-19990531-m3-gabbergirl . tssf-19991001-switchcraft-vandenbroek-56k . tssf-19991004-mcubed-gabbergirl . tssf-1999-djspree-mixtapeAside .

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

• Миксы и Мегамиксы.
• Zagedan