... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>58) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... education . research . ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...

Еще в разделе: (Показать все результаты (>13) - nano.msu.ru/ )

• Dye-sensitized Solar Cells ? Materials and Interfaces | Научно-образовательный

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>98) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>101) - uneex.mithril.cs.msu.su/ )

• FrBrGeorge/ActualEducationalTasks/S5_Interface - UNИX

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>266) - uneex.lorien.cs.msu.su/ )

• perchild - Apache HTTP Server
• Chapterљ3.љUser Interface
• Conditionals

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>65) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>166) - www.philol.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>115) - biochem.bio.msu.ru/ )

• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase
• Biochemistry Department of Moscow State University | Na,K-ATPase and its role
• Effect of disulfide crosslinking on thermal transitions and chaperone-like

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>65) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>824) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Order Chiroptera
• Two sympatric phylogroups of the Asian badger Meles leucurus (Carnivora:

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Microcontroller Programming

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>119) - herba.msu.ru/ )

• Publications about flora
• Complete flora of islands and lakes as a statistical hypothesis

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>57) - brain.bio.msu.ru/ )

• Links -- Laboratory for Neurophysiology and Neuro-Computer Interfaces (MSU,
• Patents -- Laboratory for Neurophysiology and Neuro-Computer Interfaces
• Sergei Shishkin * Сергей Шишкин

... Полная версия этой страницы: Аспирантура в США . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Academic requirements will be completed as part of the Applied Mathematics Program. ... Application information is at:http://www.memphis.edu/gradcatalog/d...g/cas/math.php. ... Applications will be considered as they are received, but not later than December 31, 2011. We look especially for prospective PhD students, but applications for Master's level will be considered as well. ...

Еще в разделе: (Показать все результаты (>184) - wasp.phys.msu.ru/ )

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>100) - phys.msu.ru/ )

• http://phys.msu.su/rus/about/structure/admin/EPFL.doc

... Вычисление полных эллиптических интегралов второго рода. Функция SF15R производит вычисление следующих интегралов /2 (1) y = (1 - x sin 2 t) 1/2 dt для 0 x 1 0 /2 (2) y = (1 - x 2 sin 2 t) 1/2 dt для -1 x 1 0 /2 (3) y = (1 - (1 - x) sin 2 t) 1/2 dt для -1 x 1 0 . ... заданное значение аргумента x (тип: вещественный); . ... подпрограмма выдачи диагностических сообщений при работе функции SF15E. Область допустимых значений аргумента для функций SF15R и SF15E указана выше при описании параметра IERR. ...

Еще в разделе: (Показать все результаты (>723) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. SF14R_P. Эллиптические функции, интегралы и связанные с ними
• БЧА НИВЦ МГУ. AMTSR_P. Транспонирование матриц
• Поясняющие фразы

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>90) - higeom.math.msu.su/ )