The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>139) - hist.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>92) - selena.sai.msu.ru/ )

• Solar eclipse of September 22, 1968.
• Yurii Naumovich Lipsky

New GCVS Version (GCVS5) FileName Explanations ----------------------------------------------------------------- ReadMe This file GCVS5 The ... ------------------------------------------------------ 1- 2 I2 --- Constell [1/88]Constellation numeric code 3- 6 I4 --- Number Star number within the constellation 7 A1 --- Component *Component identification 9- 18 A10 --- GCVS * Variable ... Field is non-blank if magMin is a magnitude or amplitude given in a system other than that indicated by magCode. ...

Еще в разделе: (Показать все результаты (>100) - sai.msu.ru/ )

• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/iii/vartype.txt
• GCVS Query forms
• General Catalogue of Variable Stars: Vols I-III (the new electronic version).

You are here: Foswiki > System Web > Skins > PatternSkin > PatternSkinCssCookbook (revision 1) E dit A ttach . ... Attach 3 new style sheets to the topic . Point the CSS preference settings in System.DefaultPreferences or Main.SitePreferences to your new files: * Set FOSWIKI_LAYOUT_URL = %PUBURLPATH%/%SYSTEMWEB%/YourNewTopic/layout.css * Set FOSWIKI_STYLE_URL = %PUBURLPATH%/%SYSTEMWEB%/YourNewTopic/style.css * Set FOSWIKI_COLORS_URL = %PUBURLPATH%/%SYSTEMWEB%/YourNewTopic/colors.css . ... System . ...

Еще в разделе: (Показать все результаты (>1693) - wiki.cs.msu.ru/ )

• ArtemTimoshenko < Main < Foswiki
• (backlinks in System Web) TemplateTopics < System < Foswiki
• (backlinks in all Webs) TemplateTopics < System < Foswiki

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>14) - engineering.phys.msu.ru/ )

• FPGA Design

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• Admission Regulation

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with J? urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + Ї Ї Ї + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>123) - higeom.math.msu.su/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>107) - www.kosmofizika.ru/ )

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>743) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>262) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... So it is with discoveries about the Earth's core and mantle. ... Using the larger of Livermore's two multi-anvil presses to mimic the pressures and temperatures that exist deep in the Earth, he has shown that metals like those in the Earth's core could not have trickled down (see figure below). ... Together, these experiments indicate that much higher temperatures were required to separate the Earth's core and mantle--temperatures high enough to melt most of the Earth. ... W. G. Minarik, et al., ...

Еще в разделе: (Показать все результаты (>1258) - geo.web.ru/ )

• Trusov Sergey's homepage The influence of boundary layer effects on the melt
• Авторский сайт Владимира Мальцева - литература

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>248) - www.philol.msu.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>59) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

.

Еще в разделе: (Показать все результаты (>30) - www.chemport.ru/ )

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>126) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>23) - observ.pereplet.ru/ )

# Observations on the sea aster (Aster tripolium). White Sea, July 2000 PLANT Number of plant SUBST Type of substrate DATE Date TIME Time (in fractions from 24 h) WATER.DIST Distance to water edge, m CLOSED Number of the completely closed heads ALMOST.CLOSED Number of heads which are almost closed HALF.CLOSED Number of half-closed heads OPENED Number of opened heads

Еще в разделе: (Показать все результаты (>202) - herba.msu.ru/ )

• Systema Naturae
• Complete flora of islands and lakes as a statistical hypothesis
• Publications about flora

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>61) - scon155.phys.msu.su/ )