... Data . ... Services . ... Solar energetic particles . ... Neutron flux variations (RU) . Solar flare database (RU) . ... Based on proton measurements onboard GOES and IMP-8, neutron monitor data and GOES X-ray measurements, this database combines information on proton events captured in near-Earth space and their possible solar sources. ... Catalogue of magnetic storms in 1998-2005 based on OMNIweb data with Dst index threshold selection capability. ... Flux intensity is indicated by pixel color. ...

Еще в разделе: (Показать все результаты (>11) - smdc.sinp.msu.ru/ )

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

... Sergei A. Astafief Ph.D., associate professor, Economics, Investment Management and Real Estate Management Department, Baikal State University of Economics and Law. ... Various participants of the market, try to solve the problems of construction of a rating of subjects of market economy. One of the responsibilities of Federal Service of Statistics is creating a rating of the enterprises on the basis of the statistical information received from them. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>227) - ee-journal.spa.msu.ru/ )

... A European science agency? Outlook on science policy . ... Vol. ... Ключевые слова: Финансирование образования. ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ЕВРОПА. ... Ключевые слова: Наука в университетах. ... ДРУГИЕ СТРАНЫ ЕВРОПЫ. СТАТЬИ . ... Guildford, 2001. ... Планы финансирования университетов Канады до 2011 г. Ключевые слова: Финансирование образования. ... Трудоустройство выпускников вузов в Великобритании как направление научной политики, 2001 г. Ключевые слова: Трудоустройство выпускников. ...

Еще в разделе: (Показать все результаты (>82) - srcc.msu.ru/ )

• Mikushin, D.N., and V.M. Stepanenko. The implementation of regional atmospheric
• Presentations and Lectures
• История НИВЦ

... 000todo . 2016-04-08 00:55 . ... 1.0K . ... Apache/2.4.10 (Debian) Server at 127.0.0.1 Port 88 ...

Еще в разделе: (Показать все результаты (>73) - herba.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

МГУ имени М.В.Ломоносова Русская версия . ... Asian and African Studies . Computational Mathematics and Cybernetics . ... Art Criticism and History . History and Art History . Section Mathematics and mechanics . ... Public Relations and Theory of Communication . ... Theory, History and Methodology of Translation . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... Theory and methods of teaching mathematics . ... МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>72) - conf.msu.ru/ )

... In this article we consider calculation of discrete Laplacian for 1D arrays using python/numpy/scipy. We introduce the sparse matrix technique that is rather efficient for computation of certain types of diffusion PDE. ... 1 комментарий " Constructing discrete Laplacian via sparse matrix " . Reaction-diffusion systems in 2D space with python ERG Research Group: Лаборатория теоретической биофизики написал (Январь 26th, 2016 2:13 пп) . ... Constructing discrete Laplacian via sparse matrix . ...

Еще в разделе: (Показать все результаты (>6) - erg.biophys.msu.ru/ )

Division of Experimental and Theoretical Physics . ... Theory of gauge fields and its applications to elementary particle physics . Unified theory of physical effects and phenomena in systems of particles with electromagnetic interaction . ... Methods of Lobachevsky geometry in non-linear problems of mathematical physics . ... Interaction of ultra-short laser pulses with matter, investigations of physical properties of new materials for quantum- and optoelectronic systems . ... Materials science . ...

Еще в разделе: (Показать все результаты (>28) - foroff.phys.msu.ru/ )

• Offered courses
• Divisions and Chairs

The Status Module is only available in Apache 1.1 and later. The Status module allows a server administrator to find out how well their server is performing. ... The number of children serving requests . ... The status of each child, the number of requests that child has performed and the total number of bytes served by the child (*) . ... Module: mod_status . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>340) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - qptrdict.h include file
• Qt Toolkit - qcache.h include file
• Qt Toolkit - qintdict.h include file

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>25) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:arzhantsev_publications | Кафедра высшей алгебры

... Geography of World Economy . ... Physical Geography and Landscape Science . ... In 1863, the Department of Physical Geography was created as a part of the Faculty of Physics and Mathematics. ... The prominent scientist and university professor D.N. Anuchin became the head of the department. ... In 1922, the Research Institute of Geography was established and the Department of Soils, Geology and Geography was organized within the Division of Natural Sciences of the Faculty of Physics and Mathematics....

Еще в разделе: (Показать все результаты (>37) - eng.geogr.msu.ru/ )

• Department of Meteorology and Climatology

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>37) - brain.bio.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Resources | ECFS
• Login | ECFS
• Dosov Botir | ECFS

The Chair of Mathematical Theory of Intelligent Systems and . ... of Moscow State University Official Website . ... Staff . ... Alexander Borisovich Kholodenko was born on November 15, 1976 in Moscow. ... Alexander Kholodenko graduated from the Faculty of Mechanics and Mathematics in 1999 as a student in mathematics and in 2002 as a post-graduate student in mathematics. ... Kholodenko A.B. About the creation of statistic language models for Russian speech recognition systems. Intelligent systems. ...

Еще в разделе: (Показать все результаты (>97) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Gasanov Elyar Eldarovich
• Intelligent Systems :: Research :: :: Articles

... Analysis of the Gibbs Method of Geome tric Picture of Thermodynamics) V. P. Maslov* and A. S. Mishchenko** *Chair of Quantum Statistics and Field Theory, Department of Physics, Moscow State University, Vorob'evy gory, Moscow, 119992 Russia **Chair of Higher Geometry and Topology, Department of Mechanics and Mathematics, Moscow State University, Vorob'evy gory, Moscow, 119992 Russia Received February 1, 2003 Abstract. ... IAPC Nauka home page | journal home page | ...

Еще в разделе: (Показать все результаты (>126) - higeom.math.msu.su/ )

• Publications of E.A.Morosova

Selected Scientific Journals . Impact Factors of Scientific Journals in 1999 . ... 0.472 SCANDINAVIAN CARDIOVASCULAR JOURNAL . 1.253 SCANDINAVIAN JOURNAL OF CLINICAL & LABORATORY INVESTIGATION . 0.573 SCANDINAVIAN JOURNAL OF FOREST RESEARCH . ... 0.138 SCANDINAVIAN JOURNAL OF LABORATORY ANIMAL SCIENCE . 0.726 SCANDINAVIAN JOURNAL OF MEDICINE & SCIENCE IN SPORTS . ... 0.928 SCANDINAVIAN JOURNAL OF REHABILITATION MEDICINE . ... 0.632 SCANDINAVIAN JOURNAL OF SOCIAL MEDICINE . ...

Еще в разделе: (Показать все результаты (>125) - www.genebee.msu.ru/ )

• GeneBee service
• Genebee Predicted Annotation
• No title

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>718) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. SF41R_P. Специальные функции математической статистики
• БЧА НИВЦ МГУ. SF41R_C. Специальные функции математической статистики

This module provides information on server activity and performance. ... Compatibility: Available in Apache 1.1 and later. ... ExtendedStatus To enable status reports only for browsers from the foo.com domain add this code to your httpd.conf configuration file <Location /server-status> SetHandler server-status Order Deny,Allow Deny from all Allow from .foo.com </Location> . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>30) - neptun.sai.msu.ru/ )

• Manual Page: logresolve - Apache HTTP Server