Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Zaytseva A.S. , Volodin I.A. , Mason M.J. , Frey R. , Fritsch G. , Ilchenko O.G. , Volodina E.V. в журнале Behavioural Processes , издательство Elsevier BV (Netherlands) , том 118, с. 130-141 DOI . ...

Еще в разделе: (Показать все результаты (>2348) - istina.msu.ru/ )

• Stochastic Processes and their Applications - журнал | ИСТИНА -
• Gaspar H.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Journal of Flow Visualization and Image Processing - журнал | ИСТИНА -

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>918) - chem.msu.ru/ )

• Segmented-flow analysis: on-line microwave sample processing for analysis of
• Role of intermediate solid phase in the process of magnesium and lanthanum
• Moscow University Chemistry Bulletin Vol. 43, No. 6, P. 381 (2002)

... Полная версия этой страницы: Аспирантура в США . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Academic requirements will be completed as part of the Applied Mathematics Program. ... Application information is at:http://www.memphis.edu/gradcatalog/d...g/cas/math.php. ... Applications will be considered as they are received, but not later than December 31, 2011. We look especially for prospective PhD students, but applications for Master's level will be considered as well. ...

Еще в разделе: (Показать все результаты (>770) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Работа в Samsung
• Студенческий форум Физфака МГУ > Новый журнал Call for Papers

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>36) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... Russian language courses: During academic year Summer courses Full-time Part-time Courses dates: from _____( day )____________( month )_____( year ) to ____( day )___________( month )______( year ) Information for visa support Citizenship __________________________________________(if more than one, please indicate them using comas) Place of birth ____________________________( country )_______________________________________ ____( ...

Еще в разделе: (Показать все результаты (>97) - www.msu.ru/ )

... Архив семинара . ... Triggered Star Formation" . It is now well established that massive stars in star forming regions can trigger next generation of star formation. ... The young stellar objects (YSOs) in star forming regions have been identified using the near-infrared (NIR) and mid-infrared (MIR) observations. ... The age of YSOs, the morphology of the regions and the global distribution of YSOs indicate that the star formation can be triggered by either (RDI/ CC) of the processes. 40 мин. ...

Еще в разделе: (Показать все результаты (>386) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Natural Satellites Data Center. Objectiv.
• HSFA 2 technical description Technical Details

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>14023) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• cca: Automata.py history
• allpy: 40c086a41ca0 .hgignore

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>112) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Интеллектуальные системы :: Наука :: :: V international congress on
• Intelligent Systems :: Magazine :: Web archive :: Volume 13, issue 1-4, 2009

The gene flow between ancient and modern humans: how often the hybridization occurred and what are population consequences? ... Then using IMa2 program [2] we reconstructed a picture of the most plausible migrations in ancient human populations. ... It is of interest that, the mitochondrial gene flow from ancient to modern humans occurred in three ways: from ancient humans to haplotypes L0 and L5, and to the offsprings of haplotype L2. ... Initial population size varied from 1000 to 10000 individuals. ...

Еще в разделе: (Показать все результаты (>279) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/179.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/131.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/179.pdf

Moscow State University Geological Faculty, Department of Geophysics . ... The signs of distortions on VES data and their role for data interpretation . ... TES field technology . ... Data processing and interpretation . ... Data visualization for TES technology. ... Field example. ... In MSU this technology appeared in 1991. ... TES modification consists of the four interconnected technologies: field measurements, data processing, visualization and interpretation. ... E-mail: sh@geophys.geol.msu.ru . ...

Еще в разделе: (Показать все результаты (>102) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• TES. Processing
• Near-surface electrical prospecting laboratory at Moscow University

Number of cores used . ... Standard MCQDPT2 benchmark using resolvent fitting , Wall clock time and relative speedup . ... Intel Quad-core Core i7 940 2.93 GHz, Asus P6T-Deluxe Mainboard, 6x2GB (triple channel) DDR3-1333 RAM@1333 MHz, Seagate 1 TB SATA-2 ST31000340NS HDD, Windows Server 2008 Enterprise x64. ... Single-point semi-direct two-state MCQDPT2 energy (using resolvent fitting code) for medium-size system (retinal molecule, cc-pVDZ, 565 Cartesian basis functions, CAS(12,12)). ...

Еще в разделе: (Показать все результаты (>109) - classic.chem.msu.su/ )

• Firefly DOCUMENTATION - command line arguments
• Just CUDing: Firefly v. 7.1.G standard MP4(SDTQ) benchmark on NVidia GPUs or
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

... The basic core of the COMAGMAT-5.2 (2013) program includes the algorithm that has been used in previous versions of the COMAGMAT model (ver. 3.0-3.5) designed to simulate mafic magma crystallization processes . ... Ariskin A.A., Bychkov K.A., Danyushevsky L.V., McNeill A.W., Barmina G.S., Nikolaev G.S. (2012) COMAGMAT-5: a new magma crystallization model designed to simulate mafic to ultramafic sulfide-saturated systems. ... Contact ariskin@geokhi.ru . ... Ariskin A.A., Barmina G.S., Frenkel M.Ya., ...

Еще в разделе: (Показать все результаты (>531) - geo.web.ru/ )

• Abstract
• Comagmat software
• Pavel Yu. Pletchov

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>32) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>4) - ndsipu.cmc.msu.ru/ )

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>22) - pont2008.cmc.msu.ru/ )

Unstable-particles pair production in MPT approach in NNLO M.L.Nekrasov IHEP, Protvino The problem: A description of processes of production and decays of fundamental unstable particles for needs of colliders of next generation (ILC) must provide (i) gauge cancellations and unitarity; (ii) enough high accuracy of calculation of resonant contributions Modified perturbation theory ( MPT ) permits direct expansion of the ...

Еще в разделе: (Показать все результаты (>176) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/mirrors/2001_2c.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_21.pdf
• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter01_Introduction.pdf

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

... TIME AS PROCESS FUNCTION . ... All said above concerns as well the time of relational concept, although it is absolutely correctly connected with material motion and interactions. ... The objectively real, functional time is formed only as a result of successive change of qualitatively new states of concrete, finite material objects, processes (each object is a process). With this each material process forms its own time in which it only exists. ... 5) Lolaev T.P. The functional concept of time. ...

Еще в разделе: (Показать все результаты (>490) - chronos.msu.ru/ )

• Laboratory-chair of Discrete mechanics on a microscopic scale
• A.P.Levich. The birth of paradigm of an open World generated by "time"
• Simakov K

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf