05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>48) - www.kosmofizika.ru/ )

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>59) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• Faculty of Geology >> Our adjunct Professors

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>140) - www.prof.msu.ru/ )

• ECA Alumni Small Grants Program
• February round of 2005 Alumni Small Grants Competition
• Fulbright New Century Scholars Program, 2006

sparallel.ru . Ботинки экко biom hike мужские . ... Мы предлагаемљкупить мужские кроссовки Adidas Porsche Design P5000 в Москве с бесплатной доставкой. ... Кроссовки Адидас Дизайн Порше Эс с легкой дышащей сеткой придадут комфорт каждому движению, уникальные металлические пружины обеспечат отличную амортизацию во время прогулок и занятий спортом. ... Кроссовки adidas porsche . Кроссовки порше дизайн адидас . Кроссовки порше адидас . Кроссовки адидас мужские порше дизайн . ...

Еще в разделе: (Показать все результаты (>16) - sparallel.ru/ )

• Abc design обувь | sparallel.ru
• admin | sparallel.ru - Part 126
• sparallel.ru - Part 126

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>32) - www.msm.biophys.msu.ru/ )

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>38) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

... April, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... The International scientific conference of students, post-graduate students and young scientists "Lomonosov" was opened at the Moscow State University in the Assembly hall of the Main building. (more.. ... MGU Russian Language Centre changed the prices for special offers and distance training web-page is coming soon. ...

Еще в разделе: (Показать все результаты (>24) - www.rlcentre.com/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>56) - erg.biophys.msu.ru/ )

• Using spherical functions (from A.Granovsky manual) ERG Research Group:
• comcon1 ERG Research Group: Лаборатория теоретической биофизики

... Женский клуб . ... Издательство МГУ . ... МГУ им.Ломоносова . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... В компании Digital Design директором бизнес-линии по работе с государственными организациями назначен Владислав Горбунов, перешедший в Digital Design из ООО "АпСкэйл Софт", входящего в группу "Оптима". ... В новой должности Владислав Горбунов будет развивать отношения с органами государственной власти. ...

Еще в разделе: (Показать все результаты (>373) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Таблетки замедляющие процесс старения уже в продаже.
• Клуб выпускников МГУ: Обсуждение материала "Развивать отношения Digital Design
• Клуб выпускников МГУ: Senior International Fellows Program

The Department of Talented Youth Affairs and Professional Orientation . ... The Faculty of Journalism of Moscow State University has announced the contest for the design creation of ?Space University? logotype and emblem. ... Criteria for the appraisal of the design: . ... Contest dates: from February 15, 2016 till May 15, 2016. For more information about the contest visit the website: www.journ.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>36) - talant.msu.ru/ )

• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional
• III Championship in an innovative educational project Cansat in Russia | The
• Emerald City | The Department of Talented Youth Affairs and Professional

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>11) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>36) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-134-1.pdf
• Maxim V. Shamolin Home Page

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>125) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/PythonDevelopment2015/07_Design - UNИX
• HelpMiscellaneous/FrequentlyAskedQuestions - UNИX

... Inside the computer's microprocessor chip, a clock distribution system delivers the timing signals from the crystal oscillator to the various circuits, just as sound in air delivers the beat of a drum to soldiers to set their marching pace. ... Beat the Clock . ... Now researchers are designing asynchronous systems that can process data without the need for a governing clock. ... Without a clock to govern its actions, an asynchronous system must rely on local coordination circuits instead. ...

Еще в разделе: (Показать все результаты (>373) - chronos.msu.ru/ )

• Table 1

1,2 - Modifyted Richter-Slefogt Camera (355mm, 200 mm) The system was designed by V.Yu.Terebizh in 2001 (terebizh@crao.crimea.ua), and then has been made by Gennadiy Borisov . ... Very Wide Field Camera near Kislovodsk: MASTER WFC-Kislovodsk . Up to 1200 square degrees up to 13 m. Very Wide Field Camera near Moscow (40 x 60 square degree) (CCD 1392 x 1040 pix, Sony). ... This system can discover and measure satellites and space refuse parameters to within 0.1 ang.sec. precision. ...

Еще в разделе: (Показать все результаты (>12) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Полная версия этой страницы: PhD: Theoretical Design of Membrane Associating Polymers . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... The PhD project focuses on the molecular design of eukaryotic cell membrane associating materials that enhance membrane functionality, and aims to: . ... The selected candidate will use the Single Chain Mean Field Theory to model synthetic membrane associating materials in the University of Tarragona, Spain. ...

Еще в разделе: (Показать все результаты (>1346) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > PhD position in molecular dynamics,
• PhD: Theoretical Design of Membrane Associating Polymers - Студенческий форум
• Студенческий форум Физфака МГУ > Работа в Samsung Electronics для математиков и

Very good EM calorimetry for e & ID and measurements + hadronic calorimetry for accurate jet and E T Miss measurements. Efficient tracking at high luminosity for high-pT leptons, e & ID, and heavy flavor ID and full event reconstruction at low luminosity. High-precision muon momentum measurements with the capability to guarantee accurate measurements at the highest luminosity using the external muon spectromrter alone. ...

Еще в разделе: (Показать все результаты (>126) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• The European X- Ray Free-Electron Laser
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов

... Bulletin of experimental biology and medicine [Bull exp biol med] . Common information . ... no information] . ... since 1980-01-01 till today . ... medicine . ... In russian till 1936. ... Russian Academy Of Medical Sciences (RAMS) . ... http://medi.ru/doc/80.htm . ...

Еще в разделе: (Показать все результаты (>465) - journals.genebee.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>161) - www.fadr.msu.ru/ )

• Untitled
• Пчелы, пчеловодство, пасека, мед, членистоногие, насекомые - Зооклуб
• "EcoPhoto" - Order photo - CD