... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>33) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>89) - uneex.mithril.cs.msu.su/ )

• Index of /static/AltlinuxOrg_Branches_ReleasePolicy
• PspoMaterials/AltlinuxOrg_Branches_ReleasePolicy - UNИX
• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>123) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

This document covers stopping and restarting Apache on Unix and Cygwin only. ... Then the parent itself exits. ... It re-reads its configuration files, and re-opens any log files. ... Note: If your configuration file has errors in it when you issue a restart then your parent will not restart, it will exit with an error. ... The USR1 signal causes the parent process to advise the children to exit after their current request (or to exit immediately if they're not serving anything). ...

Еще в разделе: (Показать все результаты (>49) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache modules
• Apache module mod_dir

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Type of field courses . ... Specialists of the same profile graduate from the branches of the Faculty, located in Sevastopol (Ukraine) and Astana (Kazakhstan). ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>109) - eng.geogr.msu.ru/ )

• Department of Social-Economic Geography of Foreign Countries

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>165) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>17) - www.issp.ac.ru/ )

• Pod-Moscowny Branch of Moscow University in Chernogolovka, Home page
• Chernogolovka
• International Olympiad of Euro-Asian Astronomical Society

... quantum optics - different types of the light interference, . ... Another branch of my activity covers the problem of biphoton interference (1997-). ... Also we developed the effective interferometric protocols to generate some specific quantum states of light (the Bell states) in the most common case: broad spectrum of the pump (in particular for the femtosecond laser), any type of phase-matching (either type-I or type-II), and arbitrary length of nonlinear crystals. ... QUANTUM TELEPORTER . ...

Еще в разделе: (Показать все результаты (>57) - qi.phys.msu.ru/ )

• PUBLIC

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>86) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>22) - srcc.msu.ru/ )

• D.D.Sokoloff, A.F.Lanza, D.L. Moss, S.M.Tarbeeva. Polar branches of stellar
• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Laboratory of Informatics

... Black, shining, dorsally in part with a barely noticeable, sometimes clearer greenish-cupreous tint; mandibles dorsally mostly red ; eyes and palpi brown ; coloration of antennae and legs somewhat variable: antennae mostly red or brown - red , with apically dark antennomeres 39 and almost entirely or completely dark last two antennomeres; profemora from almost completely brown and red only at base to mostly red with a ... Femora, tibiae and tarsi in male more robust than in female. ...

Еще в разделе: (Показать все результаты (>842) - zmmu.msu.ru/ )

• Global fossil bat records - abstract
• Russian Journal of Theriology
• Order Chiroptera

... The study is focused on forest ecosystems exposed to extreme air pollution from the nickel-processing industry in Northern Fennoscandia. Long-term deposition of heavy metals and sulphur has caused strong soil contamination and severe damage to trees and ground vegetation, their structure, composition and chemistry. ... Multivariate analyses show that changes in the element composition of plants depend both on air pollution and on natural factors. ...

Еще в разделе: (Показать все результаты (>29) - eco.soil.msu.ru/ )

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>11) - new.choir.msu.ru/ )

• Concerts | Academic choir of Moscow State University
• Conductor | Academic choir of Moscow State University
• Contacts | Academic choir of Moscow State University

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>34) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>31) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рег.: ... Рейтинг: 575 . Re: Хоккей ЧМ 2008 [ re: sWIN ] . 03.05.2008 15:15 . ... Re: Хоккей ЧМ 2008 [ re: Zigzag ] . ... Re: Хоккей ЧМ 2008 [ re: maratrus ] . ...

Еще в разделе: (Показать все результаты (>516) - www.snto-msu.net/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• Little Children ... этот фильмец есть у кого?... - Public forum of MSU united
• Вопрос по поступлению на PhD - Public forum of MSU united student networks

DEADLINE: Tuesday, February 1, 2005 I. Program Overview The ECA Alumni Small Grants Program (ASGP) is a professional and community development program open to alumni of the following ECA-sponsored exchange programs: the Contemporary Issues Fellowship Program (CI), the FREEDOM Support Act Undergraduate Program (FSAU), the Regional Scholars Exchange Program (RSEP) and the Russian-US Young Leadership Fellows for Public Service Program (YLF.) ... 2005 ECA Alumni Small Grants Program [pic] ...

Еще в разделе: (Показать все результаты (>62) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Institute of Civilization
• A Unique Opportunity for Young Americans and Russians to Volunteer Abroad!