.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>7) - www.issp.ac.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>124) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• Performance Analyzer. Preliminary design
• Prefictor of DVM-program performance. Preliminary design

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>126) - higeom.math.msu.su/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_setenvif Apache 1.3 and up . ... mod_unique_id Apache 1.3 and up . ... Determining document types using file extensions . ... mod_rewrite Apache 1.2 and up . ... User authentication using text files . ... User authentication using DBM files . ... User authentication using Berkeley DB files . mod_auth_anon Apache 1.1 and up . ... User-configurable logging replacement for mod_log_common . ...

Еще в разделе: (Показать все результаты (>69) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache module mod_dir
• An In-Depth Discussion of Virtual Host Matching

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>54) - acat02.sinp.msu.ru/ )

... 125009, Russian Federation, Moscow, MSU, 11 Mohovaya St., Institute of Asian and African studies . ... The history of studying languages and Oriental cultures in Moscow State University (MSU) started in the fifties of the 18th century. ... Students are welcome to deepen their knowledge in Philology, History, Economics of Asian and African countries at study programs of our Institute and receive MAљ . The IAAS MSU has several master degree programs (course "Asian and African Studies"): . ...

Еще в разделе: (Показать все результаты (>102) - www.msu.ru/ )

• FACULTY OF PSYCHOLOGY
• Master studies
• Specialist studies

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>221) - site2010.sai.msu.ru/ )

• General information

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... News . ... The major part of the course is dedicated to the studying measuring devices and units for data collection and processing, re-engineering of unknown circuits. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ... Working on a course project: testing of a board or a device with unknown malfunctioning, faultfinding and debugging, demonstration of the functioning device. ... 2013-2015 Engineering Physics Laboratory...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>47) - www.msm.biophys.msu.ru/ )

... Navier-Stokes Based Models in Computational Aeroacoustics . ... The same high accuracy numerical scheme is proposed for the numerical implementation of all the models. It is illustrated that a good efficiency of predictions is provided not only by the scheme accuracy, but also by such computational properties as differential model accuracy and round off errors. The following particular aspects are discussed: the influence of nonlinear effects and the treatment of very small perturbations. ...

Еще в разделе: (Показать все результаты (>186) - acs366.phys.msu.su/ )

• General Information

Use of humates to remediate polluted environments: . ... Picture gallery of the events . ... Understanding the structure and chemical reactivity of humic substances . ... Hertkorn, N., Application of NMR spectroscopy for analytical characterization of natural organic matter and humic substances. ... Application of capillary electrophoresis for analytical characterization of humic substances and of their interaction with ecotoxicants. ... Cultural event (Moscow Kremlin, Armory, Bolshoi Theater) . ...

Еще в разделе: (Показать все результаты (>131) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches

... 21 и 22 сентября 2010 года в Токио пройдет 2-ая российско-японская конференция ?The 2nd Russian-Japanese Young Scientists Conference on NanoMaterials and NanoTechnology?. Семинар организуется Токийским институтом технологий (TokyoTech) совместно с компанией Токио-Боеки и НОЦ МГУ. ...

Еще в разделе: (Показать все результаты (>13) - nano.msu.ru/ )

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>37) - shamolin2.imec.msu.ru/ )

• Maxim V. Shamolin Home Page

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf
• http://www.eng.math.msu.su/download/Margaret_Thatcher_article_and_vocabulary.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>9) - lhe.sinp.msu.ru/ )

... Полная версия этой страницы: The Significance of Non-ergodic Property of Statistical Mechanics Systems for Understanding Resting State of a Living Cell . ... The Significance of Non-ergodic Property of Statistical Mechanics Systems for Understanding Resting State of a Living Cell . ... In his physical theory of the cell, American physiologist Gilbert Ling introduced an important notion of the resting state of the cell. ...

Еще в разделе: (Показать все результаты (>579) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > уходят лучшие...
• The Significance of Non-ergodic Property of Statistical Mechanics Systems for