... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>66) - www.msm.biophys.msu.ru/ )

PETER SIMON PALLAS`S (1741-1811) . BOTANICAL AND ZOOLOGICAL . COLLECTIONS AND DRAWINGS . ... Herbarium of Komarov Botanical Institute St. Petersburg, 197376 Russia . ... The pioneer of field biological research in botany and zoology was such an attentive and acute observer of nature as Peter Simon Pallas . ... The collections of mammals, birds, insects are dispersed. ... At present all the material is housed in the St.Petersburg branch of the Archives of the Russian Academy of Science.. ...

Еще в разделе: (Показать все результаты (>269) - herba.msu.ru/ )

• Systema Naturae
• Complete flora of islands and lakes as a statistical hypothesis
• Publications about flora

... Possible constructions of reaction layers are compared, and the potential region in which continuous tungstate layer can be considered as a salt-like interlayer with barrier properties is singled out. ... In this communication, we report the tungstate effects on a number of electrode reactions on mercury and present the assumptions concerning possible structures of reaction layers at tungstate-modified surfaces. ... 0.2 V which can be attributed to some restructuring of adlayer. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

• Frumkin Institute, Theoretical Department
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage
• Laboratory of Electrical Double Layer and Electrode Kinetics

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>541) - www.fadr.msu.ru/ )

• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD
• Proposition

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>943) - www.philol.msu.ru/ )

... Dr. Rodrigues, M1 group, Spain, has pointed out the confusion in identification of SN 1998ar in NGC 2916. ... I have measured the locations of point-like sources around NGC 2916 with DSS-1 image and 5 GSC stars. ... The magnitude of this star is estimated as 15.5 mag or so on DSS1 image. ... Star C seems to be dimmer than Star B, and comparing GSC 14.8 mag star and fainter neighbouring stars, its magnitude is about 1.5 mag dimmer than GSC 14.8 mag star; which tells that SN was about 16.3 mag. ...

Еще в разделе: (Показать все результаты (>221) - www.rochesterastronomy.org/ )

• Supernova 1998ey in NGC 7080
• Supernova 2001bq in NGC 5534
• Supernova 1999X in CGCG 180-22

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>173) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2013novosibirskGD-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013tianjin-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013mexico-talk.pdf

... Then cucumber plants were harvested and subjected to measuring shoots and roots length and weight and chlorophyll content. ... The influence of commercial iron chelate Fe-EDDHA parent humic material K-Sh and its Feenriched derivative Fe-Sh on cucumber shoots'(a) and roots' (b) weight and length increase. As it can be seen from the Figure 1, plants treated with Fe-EDDHA or Fe-Sh possessed higher weight and length of both shoots and roots as compared to blank. ...

Еще в разделе: (Показать все результаты (>127) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2007/shcherbina-reduction-2007.pdf
• http://www.mgumus.chem.msu.ru/hit-2010/docs/abstract_template%5BHIT-2010%5D.doc
• http://www.mgumus.chem.msu.ru/hit-2012/docs/abstract_template%5Bhit-2012%5D.doc

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>183) - srcc.msu.ru/ )

• Approximation of Abstract Differential Equations
• Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff,
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>88) - biochem.bio.msu.ru/ )

• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

Supercontinuum upon the filamentation in fused silica of femtosecond laser radiation of different wavelengthes Annotation Formation of frequency-angular spectrum of supercontinuum emission observed upon the filamentation in fused silica KU-1 of femtosecond laser pulses on different wavelengthes was studied experimentally and numerically. ... Main attention was paid to investigation of formation of frequency-angular spectrum of conical emission along the filament under invariable parameters of pulses. ...

Еще в разделе: (Показать все результаты (>108) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2008/Dolgovsky_Chikishev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2009/Yakimchuk_Andreev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Bogdanov_Molotkov_en.pdf

Lomonosov Moscow State University was established in 1755 . ... Faculties . ... The Faculty offers Specialist Degree programs (6 years) and Master?s Degree programs (2 years). Students at the Moscow State University Faculty of Psychology are obliged to study two foreign languages: English, for five years, plus two years? study of the second foreign language (chosen by the student. ... The duration of Master?s Degree programs is 2 years (daytime study), or 2.5 years (evening study). ...

Еще в разделе: (Показать все результаты (>138) - www.msu.ru/ )

• Lomonosov Moscow State University Institute of Russian Language and Culture
• Specialist studies
• Master studies

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>184) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4
• Lib-DVM. Interface description. Part 5 (14-15)
• Lib-DVM library. Detailed design. Part 2

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>10) - theorphys.phys.msu.ru/ )

wLake 1.7 algrithm = Min vertices then return NULL If G is complete then return G Vmin := a vertex from G with the minimal valence Vs := { Vmin } {vertices connected with Vmin } Es := {edges connecting any pair of vertices Vs} G' := new Graph () For each V Vs do Add copy of V into G' For each E Es do Add copy of E into G' Delete Vmin from G return wLake (G) wLake (G') This generally exponential The result of the program is a list of ConWMs. ...

Еще в разделе: (Показать все результаты (>9) - mouse.belozersky.msu.ru/ )

• S : rm_systems

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>246) - phys.msu.ru/ )

• Title
• SAMSUNG EDUCATIONAL PROGRAMS

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>48) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

DEADLINE: Tuesday, February 1, 2005 I. Program Overview The ECA Alumni Small Grants Program (ASGP) is a professional and community development program open to alumni of the following ECA-sponsored exchange programs: the Contemporary Issues Fellowship Program (CI), the FREEDOM Support Act Undergraduate Program (FSAU), the Regional Scholars Exchange Program (RSEP) and the Russian-US Young Leadership Fellows for Public Service Program (YLF.) ... 2005 ECA Alumni Small Grants Program [pic] ...

Еще в разделе: (Показать все результаты (>223) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Institute of Civilization
• Small Grants for Russian Fulbright and Humphrey Alumni, Fall 2006