Another mechanical model of parametrically excited pendulum and stabilization of its inverted equilibrium position Anton O. Belyakov 1 Lomonosov Moscow State University 2 Vienna University of Technology 8th European Nonlinear Dynamics Conference (ENOC 2014) Vienna, July 7, 2014 Scheme of a parametric pendulum y O l (t ) - g m 2 r1 + m 2 Equations of motion mr 2 1 d d2 + c1 + m g l (t ) sin () = 0 dt 2 dt (1) Dimensionless equation Three dimensionless parameters and ...

Еще в разделе: (Показать все результаты (>13) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/0910.3802.pdf
• http://belyakov.imec.msu.ru/papers/ENOC2008.pdf

... E-MAIL ADDRESS: D.Khmelev@newton.cam.ac.uk . A new statistical method in the analysis of literary style for disputed authorship resolution is considered here. ... Consider a sequence of letter of text as a Markov chain. ... Suppose we take the logarithm of each probability, change a sign, and divide it by the length of control text; then each of the numbers obtained is called the relative empirical entropy . Relative empirical entropy is more convenient for computing than actual probabilities. ...

Еще в разделе: (Показать все результаты (>82) - old.philol.msu.ru/ )

• Footnotes
• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>24) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>12) - erp.cmc.msu.ru/ )

... Otherwise we will never recognize you and your homeworks. ... Afterwards you can go ahead and upload your homework to the system. You can also find your rating. ... To upload Homework - choose the corresponding task and press "Submit". labadmin's blog . ...

Еще в разделе: (Показать все результаты (>97) - nanolab.phys.msu.ru/ )

• labadmin's blog | Laboratory of Nanophotonics & Metamaterials
• labadmin's blog | Лаборатория нанооптики и метаматериалов

... heat and mass transfer; . kinetic theory of gases; . ... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>11) - lab106.imec.msu.ru/ )

... The integrals were used as structural descriptors. ... Results of classification analysis using descriptors generated from the data of C NMR , elemental analysis and SEC Data Linear Discriminant Analysis K nearest neighbours Classification of Descriptors * Classification of Descriptors * test samples, % test samples, % 13 C NMR 62 CHX , CH3O , COO , 67 CHn, CH3O , CARX, CAR, CH2X, C=O CHX , CARX, COO 13 C NMR 68 CHX , Mw, CARX, ...

Еще в разделе: (Показать все результаты (>141) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-uptake.pdf
• Instructions for book-contributors
• IHSS-14

... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the Ginzburg­Landau equations are often used in combination with the Ginzburg­Landau free energy of the superconductor. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Russian Basic Research Foundation (N 99-07-90326) . World Online Data Center" . ... Russian Basic Research Foundation (N 00-07-90100) . ... Project leader is Dr. V.Gitis . ... Spatio-temporal data mining and prognosis of public and environmental phenomena and processes" . ... Leader of Russian part of the Project is V.Gitis . IST Programme (EU IST - 10536 SPIN!) Spatial Mining for Data of Public Interest" . ...

Еще в разделе: (Показать все результаты (>468) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Solovova.htm
• http://geo.web.ru/~ariskin/docs/papers/p06_071.pdf
• http://geo.web.ru/conf/alkaline/2009/Andreeva.htm

Mid-infrared femtosecond pulse sp ectroscopy of molecular resonances in gas media. ... Pulse spetrometry and termometry of gas media technique based on analysis of spectral and time-domain representations of probe pulse is proposed and tested on carbon dioxide. Numerical modelling of ultrashort infrared pulse propagation in carbon dioxide of atmospheric concentrtion was implemented as well as modelling of characterisation of this pulse based on Frequency Resolved Optical Gating (FROG) technique. ...

Еще в разделе: (Показать все результаты (>332) - ofvp.phys.msu.ru/ )

• Публикация
• Грант подробно

International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...

Еще в разделе: (Показать все результаты (>752) - ilc.phys.msu.ru/ )

• Setup for material analysis by laser ablation spectroscopy
• Grant detail
• Грант подробно

... There is no trigger -- channels are sampled continuously and written first to disk, later to tape Total data rate from each interferometer: ~3 MB/sec Gravitational wave channel is only ~2% of the data stream Data to be archived: ~100-200 TB per year ACAT 2002 Peter Shawhan ( LIGO / Caltech ) Gravitational-Wave Data Analysis Different scientific topics require different ...

Еще в разделе: (Показать все результаты (>72) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/InfoBull2.txt
• http://acat02.sinp.msu.ru/page0.html
• http://acat02.sinp.msu.ru/presentations/shibzoukhov/acat2002_spnn.pdf

.

Еще в разделе: (Показать все результаты (>6) - lab110.imec.msu.ru/ )

... 112B, A.Parkes, P.West, Phys.Lett. ... With the dimensional reduction the -function was calculated even in the four-loop approximation. ... However for supersymmetric theories integrals, defining the -function, can be easily calculated, because the integrands are total derivatives. ... 13 % ' $ Conclusion and op en questions With the higher derivative regularization integrals, defining the -function, at least in the lowest loops can be easily taken, because the integrands are total derivatives. ...

Еще в разделе: (Показать все результаты (>196) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter10_Cost-Time%20Schedule.pdf
• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>83) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf
• http://qilab.phys.msu.ru/papers/LPL-FM-2006.pdf
• http://qilab.phys.msu.ru/papers/JETP-1998-86(1)-en.pdf

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>76) - scon155.phys.msu.su/ )

• Influence of random fields on the ferroelectric phase transition in IV-VI

Control of Diffeomorphisms and Densities Andrei A. Agrachev SISSA, Trieste, Italy and Steklov Mathematical Institute, Moscow, Russia e-mail: agrachev@sissa.it Consider a classical control system as it was defined by Pontryagin: x = f (x, u), x M , u U. (1) Assume that the state space M is a smooth manifold , the set of control parameters U is a closed subset of another smooth manifold , the righthand side f is ...

Еще в разделе: (Показать все результаты (>64) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gauthier.pdf
• Program Международная конференция Дифференциальные уравнения и топология ,

The name of film studio "Eh-Film" should be understood as phonetical reverberation of two key letters in ElectroChemistry. ... Academician Frumkin arrives to his Dept in Moscow University (usually he had spent two days at the Dept, and other days were devoted to his Institute). Staff is waiting for Frumkin in his office, and disappear from the office when Frumkin approaches the Dept. ... Finally Frumkin proposes the student to continue his experimental work for two weeks. ...

Еще в разделе: (Показать все результаты (>86) - electr003.chem.msu.ru/ )

• RADEN Data Bank
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage
• Nanostructured SnO2-TiO2 films as related to lithium intercalation